Mutagenetix > Incidental Mutation

Incidental Mutation 'R7940:Alpk3'

649001

Institutional Source

Beutler Lab

Gene Symbol

Alpk3

Ensembl Gene

ENSMUSG00000038763

Gene Name

alpha-kinase 3

Synonyms

Midori

MMRRC Submission

045986-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R7940 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81057600-81105612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81093945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1170 (P1170L)

Ref Sequence

ENSEMBL: ENSMUSP00000102971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107348]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107348
AA Change: P1170L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: P1170L

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
IGc2	89	159	2.78e-11	SMART
low complexity region	183	192	N/A	INTRINSIC
low complexity region	400	427	N/A	INTRINSIC
low complexity region	514	532	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	958	971	N/A	INTRINSIC
low complexity region	1048	1058	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC
IG_like	1264	1330	5.73e-2	SMART
low complexity region	1350	1359	N/A	INTRINSIC
Alpha_kinase	1395	1592	1.17e-44	SMART

Meta Mutation Damage Score

0.1001

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,351,038	M238T	probably benign	Het
Acacb	C	T	5: 114,166,047	S177F	possibly damaging	Het
Afap1l2	A	G	19: 56,914,165	V822A	probably damaging	Het
Akap2	A	G	4: 57,883,026	K790E	probably damaging	Het
Aox3	A	G	1: 58,188,437	I1234V	probably damaging	Het
Ascc1	G	A	10: 60,012,559	V103M	probably null	Het
Brca2	C	G	5: 150,538,733	T654S	probably benign	Het
Cblb	T	C	16: 52,152,536	F410S	probably damaging	Het
Cep95	T	A	11: 106,796,148	N94K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cpe	T	A	8: 64,594,911	S440C	probably damaging	Het
Cspg4	C	T	9: 56,888,097	Q1039*	probably null	Het
Cul5	A	T	9: 53,623,769	S612T	probably benign	Het
Dapl1	T	C	2: 59,484,768		probably null	Het
Deptor	C	T	15: 55,208,848	T241M	probably benign	Het
Dnaaf1	A	G	8: 119,582,715	T181A	possibly damaging	Het
Dnajc11	G	T	4: 151,968,588	Q156H	probably benign	Het
Dst	T	C	1: 34,167,676	V975A	possibly damaging	Het
Elf3	T	A	1: 135,257,128	S107C	probably damaging	Het
Enpp2	T	A	15: 54,906,928	D105V	probably damaging	Het
Fam122a	G	A	19: 24,477,188	R57W	probably benign	Het
Fgd6	G	A	10: 94,120,482	V1008I	probably benign	Het
Frmpd2	C	T	14: 33,554,893	R1157*	probably null	Het
Gabrg2	A	C	11: 41,967,647	V218G	probably benign	Het
Gdpgp1	C	T	7: 80,239,205	A328V	probably damaging	Het
Glis1	C	G	4: 107,632,374	F719L	probably damaging	Het
Glis1	A	T	4: 107,632,375	N720Y	probably damaging	Het
Grin2c	G	T	11: 115,255,281	A546D	probably damaging	Het
Gtf3c5	G	A	2: 28,568,580	T433I	possibly damaging	Het
Jmjd6	C	A	11: 116,843,229		probably benign	Het
Kctd14	T	C	7: 97,457,684	S49P	probably damaging	Het
Lamc2	T	A	1: 153,130,775	K877*	probably null	Het
Lgr4	T	A	2: 110,006,513	S397R	probably damaging	Het
Lrp2	A	T	2: 69,432,197	I4420N	possibly damaging	Het
Lyn	A	G	4: 3,783,089	K441E	possibly damaging	Het
Minpp1	A	T	19: 32,485,959	S7C	possibly damaging	Het
Mrps9	T	A	1: 42,862,648	D105E	probably damaging	Het
Ncoa1	C	A	12: 4,313,095	A247S	possibly damaging	Het
Olfr548-ps1	G	A	7: 102,542,308	R124H	possibly damaging	Het
Olfr893	T	C	9: 38,209,200	V47A	probably benign	Het
Pcdh15	G	A	10: 74,594,190	V1250I	probably damaging	Het
Pcdha12	A	T	18: 37,020,356	T43S	probably damaging	Het
Pkn2	G	A	3: 142,810,719	R549C	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Polq	T	A	16: 37,060,642	M1056K	probably benign	Het
Ppp1r12b	A	T	1: 134,876,055	N455K	probably benign	Het
Rhbdf1	T	A	11: 32,216,258	M1L	possibly damaging	Het
Rspry1	G	T	8: 94,623,007	V8L	probably benign	Het
Slc6a20b	A	G	9: 123,607,601	V249A	probably damaging	Het
Smok2b	A	T	17: 13,236,159	H402L	possibly damaging	Het
Supt20	A	T	3: 54,713,199	N393I	probably benign	Het
Tcp11l1	T	C	2: 104,698,648	K102E	probably damaging	Het
Tpbgl	T	C	7: 99,625,591	Y353C	probably damaging	Het
Usp24	A	T	4: 106,430,544	Q2465L	probably damaging	Het
Vmn2r116	T	A	17: 23,386,972	M286K	probably damaging	Het
Wnt16	C	A	6: 22,291,189	N205K	possibly damaging	Het
Xkr7	C	A	2: 153,032,215	F67L	probably damaging	Het
Zfp473	T	G	7: 44,734,576	E111A	probably damaging	Het
Zfp74	T	C	7: 29,932,442	K126E	probably benign	Het

Other mutations in Alpk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Alpk3	APN	7	81078009	missense	possibly damaging	0.95
IGL00472:Alpk3	APN	7	81095653	splice site	probably benign
IGL01732:Alpk3	APN	7	81057642	missense	unknown
IGL01750:Alpk3	APN	7	81092282	missense	probably damaging	1.00
IGL01812:Alpk3	APN	7	81100202	missense	probably damaging	1.00
IGL02224:Alpk3	APN	7	81076868	splice site	probably benign
IGL02292:Alpk3	APN	7	81077905	missense	possibly damaging	0.46
IGL02340:Alpk3	APN	7	81078507	missense	probably benign	0.03
IGL02517:Alpk3	APN	7	81077895	missense	probably benign	0.00
IGL02725:Alpk3	APN	7	81093610	missense	possibly damaging	0.91
IGL02755:Alpk3	APN	7	81093759	missense	possibly damaging	0.71
IGL03035:Alpk3	APN	7	81078604	missense	probably benign	0.00
IGL03102:Alpk3	APN	7	81095056	critical splice donor site	probably null
IGL03153:Alpk3	APN	7	81093395	missense	probably benign	0.00
IGL03255:Alpk3	APN	7	81092562	missense	probably benign	0.01
IGL03367:Alpk3	APN	7	81094990	missense	probably benign	0.01
FR4304:Alpk3	UTSW	7	81077762	small insertion	probably benign
FR4737:Alpk3	UTSW	7	81077762	small insertion	probably benign
IGL03097:Alpk3	UTSW	7	81093909	missense	probably benign	0.00
R0092:Alpk3	UTSW	7	81092553	missense	probably benign
R0254:Alpk3	UTSW	7	81076974	missense	probably benign	0.43
R0310:Alpk3	UTSW	7	81078610	missense	possibly damaging	0.61
R0325:Alpk3	UTSW	7	81067953	missense	possibly damaging	0.58
R0387:Alpk3	UTSW	7	81104227	missense	possibly damaging	0.93
R0971:Alpk3	UTSW	7	81092579	missense	possibly damaging	0.55
R1078:Alpk3	UTSW	7	81078600	missense	probably benign
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1168:Alpk3	UTSW	7	81103357	missense	probably damaging	1.00
R1306:Alpk3	UTSW	7	81093873	missense	probably damaging	1.00
R1822:Alpk3	UTSW	7	81076931	nonsense	probably null
R2173:Alpk3	UTSW	7	81076900	missense	probably damaging	1.00
R2350:Alpk3	UTSW	7	81094970	missense	probably damaging	1.00
R2414:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2417:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2885:Alpk3	UTSW	7	81100192	missense	probably damaging	1.00
R3004:Alpk3	UTSW	7	81103355	nonsense	probably null
R3796:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3797:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3798:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3799:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3894:Alpk3	UTSW	7	81078390	missense	possibly damaging	0.93
R4395:Alpk3	UTSW	7	81094955	missense	probably damaging	1.00
R4761:Alpk3	UTSW	7	81104168	missense	probably damaging	0.99
R5505:Alpk3	UTSW	7	81078561	missense	possibly damaging	0.87
R5540:Alpk3	UTSW	7	81095436	missense	probably damaging	1.00
R5770:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R5941:Alpk3	UTSW	7	81078653	missense	probably damaging	1.00
R5964:Alpk3	UTSW	7	81092260	missense	possibly damaging	0.88
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6066:Alpk3	UTSW	7	81076950	missense	possibly damaging	0.89
R6517:Alpk3	UTSW	7	81078579	missense	possibly damaging	0.54
R6578:Alpk3	UTSW	7	81078684	missense	probably benign	0.00
R7230:Alpk3	UTSW	7	81093294	missense	probably damaging	1.00
R7266:Alpk3	UTSW	7	81092580	missense	possibly damaging	0.55
R7271:Alpk3	UTSW	7	81078454	missense	possibly damaging	0.92
R7402:Alpk3	UTSW	7	81076912	missense	probably benign	0.29
R7411:Alpk3	UTSW	7	81092852	missense	probably benign	0.11
R7454:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R7468:Alpk3	UTSW	7	81100998	nonsense	probably null
R8157:Alpk3	UTSW	7	81093722	missense	probably benign	0.00
R8246:Alpk3	UTSW	7	81092776	missense	probably benign	0.00
R8357:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8444:Alpk3	UTSW	7	81057720	missense	probably benign	0.08
R8457:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8775:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8775-TAIL:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8794:Alpk3	UTSW	7	81057655	missense	unknown
R8982:Alpk3	UTSW	7	81099002	missense	probably damaging	1.00
R9259:Alpk3	UTSW	7	81093554	missense	probably damaging	1.00
R9343:Alpk3	UTSW	7	81092331	missense	probably benign	0.27
R9567:Alpk3	UTSW	7	81092939	missense	possibly damaging	0.55
R9792:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9793:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9798:Alpk3	UTSW	7	81092652	missense	probably benign	0.02
RF034:Alpk3	UTSW	7	81092414	small deletion	probably benign
RF057:Alpk3	UTSW	7	81092417	frame shift	probably null
X0022:Alpk3	UTSW	7	81093897	missense	probably damaging	0.96
Z1176:Alpk3	UTSW	7	81078626	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGCCAAGAAGAAGCAATGC -3'
(R):5'- GCACTCACCTTTTAGCAGGTC -3'

Sequencing Primer
(F):5'- CCAGGGGAGGCTTTGACG -3'
(R):5'- TGCTTGGCCAGAGCTTC -3'

Posted On

2020-09-15