Mutagenetix > Incidental Mutations

Incidental Mutation 'R7940:Polq'

649025

Institutional Source

Beutler Lab

Gene Symbol

Polq

Ensembl Gene

ENSMUSG00000034206

Gene Name

polymerase (DNA directed), theta

Synonyms

A430110D14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R7940 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37011786-37095417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37060642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1056 (M1056K)

Ref Sequence

ENSEMBL: ENSMUSP00000059757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]

AlphaFold

Q8CGS6

Predicted Effect

probably benign
Transcript: ENSMUST00000054034
AA Change: M1056K

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: M1056K

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
DEXDc	87	298	4.09e-18	SMART
HELICc	398	484	4.02e-17	SMART
Blast:DEXDc	485	550	2e-25	BLAST
low complexity region	609	626	N/A	INTRINSIC
PDB:2ZJA\|A	712	826	5e-9	PDB
low complexity region	845	852	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1126	1149	N/A	INTRINSIC
low complexity region	1813	1822	N/A	INTRINSIC
POLAc	2265	2504	3.3e-101	SMART
low complexity region	2521	2531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000071452
AA Change: M777K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: M777K

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	216	5.9e-12	PFAM
low complexity region	330	347	N/A	INTRINSIC
PDB:2ZJA\|A	433	547	5e-9	PDB
low complexity region	566	573	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	847	870	N/A	INTRINSIC
low complexity region	1534	1543	N/A	INTRINSIC
POLAc	1986	2225	3.3e-101	SMART
low complexity region	2242	2252	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182946

SMART Domains

Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183112

SMART Domains

Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,351,038	M238T	probably benign	Het
Acacb	C	T	5: 114,166,047	S177F	possibly damaging	Het
Afap1l2	A	G	19: 56,914,165	V822A	probably damaging	Het
Akap2	A	G	4: 57,883,026	K790E	probably damaging	Het
Alpk3	C	T	7: 81,093,945	P1170L	probably damaging	Het
Aox3	A	G	1: 58,188,437	I1234V	probably damaging	Het
Ascc1	G	A	10: 60,012,559	V103M	probably null	Het
Brca2	C	G	5: 150,538,733	T654S	probably benign	Het
Cblb	T	C	16: 52,152,536	F410S	probably damaging	Het
Cep95	T	A	11: 106,796,148	N94K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cpe	T	A	8: 64,594,911	S440C	probably damaging	Het
Cspg4	C	T	9: 56,888,097	Q1039*	probably null	Het
Cul5	A	T	9: 53,623,769	S612T	probably benign	Het
Dapl1	T	C	2: 59,484,768		probably null	Het
Deptor	C	T	15: 55,208,848	T241M	probably benign	Het
Dnaaf1	A	G	8: 119,582,715	T181A	possibly damaging	Het
Dnajc11	G	T	4: 151,968,588	Q156H	probably benign	Het
Dst	T	C	1: 34,167,676	V975A	possibly damaging	Het
Elf3	T	A	1: 135,257,128	S107C	probably damaging	Het
Enpp2	T	A	15: 54,906,928	D105V	probably damaging	Het
Fam122a	G	A	19: 24,477,188	R57W	probably benign	Het
Fgd6	G	A	10: 94,120,482	V1008I	probably benign	Het
Frmpd2	C	T	14: 33,554,893	R1157*	probably null	Het
Gabrg2	A	C	11: 41,967,647	V218G	probably benign	Het
Gdpgp1	C	T	7: 80,239,205	A328V	probably damaging	Het
Glis1	C	G	4: 107,632,374	F719L	probably damaging	Het
Glis1	A	T	4: 107,632,375	N720Y	probably damaging	Het
Grin2c	G	T	11: 115,255,281	A546D	probably damaging	Het
Gtf3c5	G	A	2: 28,568,580	T433I	possibly damaging	Het
Jmjd6	C	A	11: 116,843,229		probably benign	Het
Kctd14	T	C	7: 97,457,684	S49P	probably damaging	Het
Lamc2	T	A	1: 153,130,775	K877*	probably null	Het
Lgr4	T	A	2: 110,006,513	S397R	probably damaging	Het
Lrp2	A	T	2: 69,432,197	I4420N	possibly damaging	Het
Lyn	A	G	4: 3,783,089	K441E	possibly damaging	Het
Minpp1	A	T	19: 32,485,959	S7C	possibly damaging	Het
Mrps9	T	A	1: 42,862,648	D105E	probably damaging	Het
Ncoa1	C	A	12: 4,313,095	A247S	possibly damaging	Het
Olfr548-ps1	G	A	7: 102,542,308	R124H	possibly damaging	Het
Olfr893	T	C	9: 38,209,200	V47A	probably benign	Het
Pcdh15	G	A	10: 74,594,190	V1250I	probably damaging	Het
Pcdha12	A	T	18: 37,020,356	T43S	probably damaging	Het
Pkn2	G	A	3: 142,810,719	R549C	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ppp1r12b	A	T	1: 134,876,055	N455K	probably benign	Het
Rhbdf1	T	A	11: 32,216,258	M1L	possibly damaging	Het
Rspry1	G	T	8: 94,623,007	V8L	probably benign	Het
Slc6a20b	A	G	9: 123,607,601	V249A	probably damaging	Het
Smok2b	A	T	17: 13,236,159	H402L	possibly damaging	Het
Supt20	A	T	3: 54,713,199	N393I	probably benign	Het
Tcp11l1	T	C	2: 104,698,648	K102E	probably damaging	Het
Tpbgl	T	C	7: 99,625,591	Y353C	probably damaging	Het
Usp24	A	T	4: 106,430,544	Q2465L	probably damaging	Het
Vmn2r116	T	A	17: 23,386,972	M286K	probably damaging	Het
Wnt16	C	A	6: 22,291,189	N205K	possibly damaging	Het
Xkr7	C	A	2: 153,032,215	F67L	probably damaging	Het
Zfp473	T	G	7: 44,734,576	E111A	probably damaging	Het
Zfp74	T	C	7: 29,932,442	K126E	probably benign	Het

Other mutations in Polq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Polq	APN	16	37065247	splice site	probably benign
IGL00539:Polq	APN	16	37060569	missense	probably damaging	0.98
IGL00960:Polq	APN	16	37060512	missense	probably damaging	0.96
IGL01100:Polq	APN	16	37061112	missense	probably benign
IGL01112:Polq	APN	16	37017309	missense	probably damaging	1.00
IGL01138:Polq	APN	16	37045869	missense	possibly damaging	0.94
IGL01432:Polq	APN	16	37071822	splice site	probably benign
IGL01522:Polq	APN	16	37027903	missense	probably damaging	1.00
IGL01565:Polq	APN	16	37013113	missense	probably benign	0.00
IGL01592:Polq	APN	16	37034850	missense	probably benign	0.01
IGL01690:Polq	APN	16	37062838	missense	probably damaging	0.97
IGL01943:Polq	APN	16	37061443	missense	possibly damaging	0.47
IGL02531:Polq	APN	16	37062374	missense	possibly damaging	0.75
IGL02553:Polq	APN	16	37041768	missense	probably damaging	1.00
IGL02623:Polq	APN	16	37060375	missense	probably benign	0.04
IGL02692:Polq	APN	16	37060627	missense	probably damaging	1.00
IGL02717:Polq	APN	16	37022740	missense	probably damaging	1.00
IGL02937:Polq	APN	16	37013109	missense	probably benign	0.14
IGL02959:Polq	APN	16	37086566	missense	probably damaging	1.00
IGL03086:Polq	APN	16	37091049	missense	probably benign	0.02
IGL03141:Polq	APN	16	37017358	splice site	probably benign
IGL03302:Polq	APN	16	37071772	missense	probably damaging	1.00
IGL03393:Polq	APN	16	37044794	missense	probably damaging	1.00
R0013_Polq_667	UTSW	16	37061839	missense	possibly damaging	0.56
R4238_Polq_233	UTSW	16	37013181	missense	probably damaging	1.00
R4280_polq_867	UTSW	16	37082057	missense	probably damaging	1.00
G1Funyon:Polq	UTSW	16	37061819	missense	probably damaging	1.00
PIT4403001:Polq	UTSW	16	37060587	missense	probably benign	0.00
R0013:Polq	UTSW	16	37061839	missense	possibly damaging	0.56
R0082:Polq	UTSW	16	37017257	missense	probably benign	0.01
R0212:Polq	UTSW	16	37066854	missense	probably damaging	0.99
R0387:Polq	UTSW	16	37029430	missense	probably damaging	1.00
R0387:Polq	UTSW	16	37089317	missense	probably damaging	1.00
R0427:Polq	UTSW	16	37061993	nonsense	probably null
R0454:Polq	UTSW	16	37034890	missense	probably damaging	0.98
R0513:Polq	UTSW	16	37094502	missense	probably damaging	1.00
R0622:Polq	UTSW	16	37060993	missense	probably benign	0.02
R0848:Polq	UTSW	16	37062130	missense	probably benign	0.08
R1142:Polq	UTSW	16	37013217	missense	probably damaging	0.98
R1218:Polq	UTSW	16	37029446	missense	possibly damaging	0.93
R1331:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R1398:Polq	UTSW	16	37062495	missense	possibly damaging	0.87
R1424:Polq	UTSW	16	37086528	missense	probably damaging	1.00
R1644:Polq	UTSW	16	37060264	missense	probably damaging	0.96
R1777:Polq	UTSW	16	37060224	missense	possibly damaging	0.94
R1820:Polq	UTSW	16	37029418	missense	possibly damaging	0.48
R1854:Polq	UTSW	16	37062109	missense	probably benign	0.01
R1880:Polq	UTSW	16	37086592	missense	possibly damaging	0.90
R1932:Polq	UTSW	16	37062304	missense	possibly damaging	0.92
R2008:Polq	UTSW	16	37062482	missense	probably damaging	0.96
R2014:Polq	UTSW	16	37078366	missense	probably damaging	1.00
R2026:Polq	UTSW	16	37062745	missense	possibly damaging	0.93
R2178:Polq	UTSW	16	37062829	missense	probably damaging	1.00
R2259:Polq	UTSW	16	37062097	missense	probably benign	0.03
R2266:Polq	UTSW	16	37062153	missense	possibly damaging	0.59
R2305:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R2370:Polq	UTSW	16	37073939	missense	probably damaging	1.00
R2504:Polq	UTSW	16	37011942	missense	unknown
R2517:Polq	UTSW	16	37089325	missense	probably damaging	1.00
R2697:Polq	UTSW	16	37042153	missense	probably damaging	1.00
R2858:Polq	UTSW	16	37062753	missense	possibly damaging	0.88
R3436:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3437:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3699:Polq	UTSW	16	37042156	missense	probably damaging	1.00
R3838:Polq	UTSW	16	37078349	missense	probably damaging	1.00
R3875:Polq	UTSW	16	37074027	missense	probably damaging	0.99
R4050:Polq	UTSW	16	37092820	critical splice acceptor site	probably null
R4172:Polq	UTSW	16	37060758	missense	probably benign	0.02
R4238:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4240:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4280:Polq	UTSW	16	37082057	missense	probably damaging	1.00
R4296:Polq	UTSW	16	37061301	missense	possibly damaging	0.94
R4360:Polq	UTSW	16	37060339	missense	probably benign	0.00
R4373:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4375:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4376:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4509:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4510:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4511:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4543:Polq	UTSW	16	37060785	missense	probably benign	0.43
R4633:Polq	UTSW	16	37048542	missense	probably damaging	1.00
R4739:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R4834:Polq	UTSW	16	37027814	missense	probably damaging	1.00
R4841:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4842:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4937:Polq	UTSW	16	37027912	missense	probably benign	0.01
R4955:Polq	UTSW	16	37061082	missense	probably benign	0.32
R4992:Polq	UTSW	16	37061162	missense	possibly damaging	0.59
R5008:Polq	UTSW	16	37062387	missense	probably benign
R5221:Polq	UTSW	16	37042178	missense	probably damaging	0.98
R5254:Polq	UTSW	16	37089319	missense	probably damaging	1.00
R5292:Polq	UTSW	16	37061383	missense	probably damaging	1.00
R5375:Polq	UTSW	16	37082784	missense	probably damaging	1.00
R5480:Polq	UTSW	16	37013290	splice site	probably benign
R5552:Polq	UTSW	16	37094510	missense	possibly damaging	0.93
R5591:Polq	UTSW	16	37011885	utr 5 prime	probably benign
R5653:Polq	UTSW	16	37040534	missense	probably damaging	1.00
R5708:Polq	UTSW	16	37061018	missense	probably damaging	0.98
R5754:Polq	UTSW	16	37017263	missense	probably benign
R5757:Polq	UTSW	16	37086681	missense	probably benign	0.01
R5764:Polq	UTSW	16	37017344	missense	probably damaging	0.97
R6019:Polq	UTSW	16	37061764	missense	probably damaging	1.00
R6170:Polq	UTSW	16	37045812	missense	possibly damaging	0.82
R6177:Polq	UTSW	16	37071709	missense	probably damaging	0.98
R6307:Polq	UTSW	16	37017356	critical splice donor site	probably null
R6499:Polq	UTSW	16	37060827	missense	probably benign	0.03
R6520:Polq	UTSW	16	37060377	missense	possibly damaging	0.88
R6598:Polq	UTSW	16	37061631	missense	probably benign	0.39
R6694:Polq	UTSW	16	37015173	missense	probably null	0.99
R6788:Polq	UTSW	16	37077148	missense	probably damaging	1.00
R7104:Polq	UTSW	16	37089353	nonsense	probably null
R7159:Polq	UTSW	16	37062853	missense	possibly damaging	0.87
R7222:Polq	UTSW	16	37086633	nonsense	probably null
R7340:Polq	UTSW	16	37060926	missense	probably benign	0.00
R7361:Polq	UTSW	16	37060428	missense	probably benign	0.00
R7384:Polq	UTSW	16	37029418	missense	probably damaging	1.00
R7509:Polq	UTSW	16	37060343	missense	probably benign
R7509:Polq	UTSW	16	37060344	missense	probably benign	0.00
R7575:Polq	UTSW	16	37091134	missense	probably benign	0.00
R7785:Polq	UTSW	16	37027877	missense	probably damaging	1.00
R7787:Polq	UTSW	16	37017309	missense	probably damaging	1.00
R7891:Polq	UTSW	16	37027882	missense	probably damaging	1.00
R7898:Polq	UTSW	16	37044883	missense	probably damaging	0.98
R7917:Polq	UTSW	16	37065288	missense	probably benign	0.08
R8028:Polq	UTSW	16	37061316	missense	possibly damaging	0.82
R8114:Polq	UTSW	16	37042215	missense	possibly damaging	0.94
R8144:Polq	UTSW	16	37029484	missense	probably benign	0.01
R8288:Polq	UTSW	16	37027910	missense	probably damaging	1.00
R8301:Polq	UTSW	16	37061819	missense	probably damaging	1.00
R8341:Polq	UTSW	16	37071771	missense	possibly damaging	0.96
R8348:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8448:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8815:Polq	UTSW	16	37033531	missense	probably damaging	1.00
R8843:Polq	UTSW	16	37011918	missense	unknown
R8878:Polq	UTSW	16	37040507	missense	probably benign	0.02
R9016:Polq	UTSW	16	37022797	missense	probably damaging	1.00
R9189:Polq	UTSW	16	37044903	missense	probably damaging	1.00
R9209:Polq	UTSW	16	37048649	missense	possibly damaging	0.94
R9352:Polq	UTSW	16	37041890	missense	probably damaging	0.98
R9398:Polq	UTSW	16	37061032	missense	probably benign	0.02
R9403:Polq	UTSW	16	37061853	missense	probably benign	0.00
X0060:Polq	UTSW	16	37017237	nonsense	probably null
Z1176:Polq	UTSW	16	37042257	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAAGAAAACGGACTTCTTTAGG -3'
(R):5'- AAGCCTGCTGCCTTTGTAAAG -3'

Sequencing Primer
(F):5'- TGCTTCGAAAGTCTCTGAAAGAAG -3'
(R):5'- AAAGGGAGTGAGGGCTTCTTGC -3'

Posted On

2020-09-15