Incidental Mutation 'R7940:Vmn2r116'
ID649028
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7940 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23386972 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 286 (M286K)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect probably damaging
Transcript: ENSMUST00000164856
AA Change: M286K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: M286K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,351,038 M238T probably benign Het
Acacb C T 5: 114,166,047 S177F possibly damaging Het
Afap1l2 A G 19: 56,914,165 V822A probably damaging Het
Akap2 A G 4: 57,883,026 K790E probably damaging Het
Alpk3 C T 7: 81,093,945 P1170L probably damaging Het
Aox3 A G 1: 58,188,437 I1234V probably damaging Het
Ascc1 G A 10: 60,012,559 V103M probably null Het
Brca2 C G 5: 150,538,733 T654S probably benign Het
Cblb T C 16: 52,152,536 F410S probably damaging Het
Cep95 T A 11: 106,796,148 N94K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cpe T A 8: 64,594,911 S440C probably damaging Het
Cspg4 C T 9: 56,888,097 Q1039* probably null Het
Cul5 A T 9: 53,623,769 S612T probably benign Het
Dapl1 T C 2: 59,484,768 probably null Het
Deptor C T 15: 55,208,848 T241M probably benign Het
Dnaaf1 A G 8: 119,582,715 T181A possibly damaging Het
Dnajc11 G T 4: 151,968,588 Q156H probably benign Het
Dst T C 1: 34,167,676 V975A possibly damaging Het
Elf3 T A 1: 135,257,128 S107C probably damaging Het
Enpp2 T A 15: 54,906,928 D105V probably damaging Het
Fam122a G A 19: 24,477,188 R57W probably benign Het
Fgd6 G A 10: 94,120,482 V1008I probably benign Het
Frmpd2 C T 14: 33,554,893 R1157* probably null Het
Gabrg2 A C 11: 41,967,647 V218G probably benign Het
Gdpgp1 C T 7: 80,239,205 A328V probably damaging Het
Glis1 C G 4: 107,632,374 F719L probably damaging Het
Glis1 A T 4: 107,632,375 N720Y probably damaging Het
Grin2c G T 11: 115,255,281 A546D probably damaging Het
Gtf3c5 G A 2: 28,568,580 T433I possibly damaging Het
Jmjd6 C A 11: 116,843,229 probably benign Het
Kctd14 T C 7: 97,457,684 S49P probably damaging Het
Lamc2 T A 1: 153,130,775 K877* probably null Het
Lgr4 T A 2: 110,006,513 S397R probably damaging Het
Lrp2 A T 2: 69,432,197 I4420N possibly damaging Het
Lyn A G 4: 3,783,089 K441E possibly damaging Het
Minpp1 A T 19: 32,485,959 S7C possibly damaging Het
Mrps9 T A 1: 42,862,648 D105E probably damaging Het
Ncoa1 C A 12: 4,313,095 A247S possibly damaging Het
Olfr548-ps1 G A 7: 102,542,308 R124H possibly damaging Het
Olfr893 T C 9: 38,209,200 V47A probably benign Het
Pcdh15 G A 10: 74,594,190 V1250I probably damaging Het
Pcdha12 A T 18: 37,020,356 T43S probably damaging Het
Pkn2 G A 3: 142,810,719 R549C probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Polq T A 16: 37,060,642 M1056K probably benign Het
Ppp1r12b A T 1: 134,876,055 N455K probably benign Het
Rhbdf1 T A 11: 32,216,258 M1L possibly damaging Het
Rspry1 G T 8: 94,623,007 V8L probably benign Het
Slc6a20b A G 9: 123,607,601 V249A probably damaging Het
Smok2b A T 17: 13,236,159 H402L possibly damaging Het
Supt20 A T 3: 54,713,199 N393I probably benign Het
Tcp11l1 T C 2: 104,698,648 K102E probably damaging Het
Tpbgl T C 7: 99,625,591 Y353C probably damaging Het
Usp24 A T 4: 106,430,544 Q2465L probably damaging Het
Wnt16 C A 6: 22,291,189 N205K possibly damaging Het
Xkr7 C A 2: 153,032,215 F67L probably damaging Het
Zfp473 T G 7: 44,734,576 E111A probably damaging Het
Zfp74 T C 7: 29,932,442 K126E probably benign Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGGTTGGTCATCTCAGACAG -3'
(R):5'- TTGACAGAGTTCAATGTCTGGAC -3'

Sequencing Primer
(F):5'- GTTGGTCATCTCAGACAGTGATCAAG -3'
(R):5'- GTCTGGACAAAATGTTTAAACCCAG -3'
Posted On2020-09-15