Mutagenetix > Incidental Mutation

Incidental Mutation 'R0015:Ncapd3'

64903

Institutional Source

Beutler Lab

Gene Symbol

Ncapd3

Ensembl Gene

ENSMUSG00000035024

Gene Name

non-SMC condensin II complex, subunit D3

Synonyms

4632407J06Rik, B130055D15Rik, 2810487N22Rik

MMRRC Submission

038310-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0015 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27030175-27095315 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27051809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 470 (A470E)

Ref Sequence

ENSEMBL: ENSMUSP00000083374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073127
AA Change: A470E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: A470E

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cnd1	949	1148	1.7e-46	PFAM
low complexity region	1192	1200	N/A	INTRINSIC
coiled coil region	1213	1270	N/A	INTRINSIC
low complexity region	1290	1315	N/A	INTRINSIC
low complexity region	1393	1410	N/A	INTRINSIC
low complexity region	1485	1498	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000086198
AA Change: A470E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: A470E

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cohesin_HEAT	536	560	4.6e-5	PFAM
Pfam:Cnd1	949	1148	6.6e-59	PFAM
low complexity region	1192	1200	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216677
AA Change: A470E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217311

Meta Mutation Damage Score

0.7204

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,186,184	R408H	probably damaging	Het
A130050O07Rik	A	G	1: 137,928,656	Y23C	unknown	Het
Adcy3	G	A	12: 4,195,260		probably null	Het
Aldh6a1	G	A	12: 84,441,780	L86F	probably damaging	Het
Arl10	G	T	13: 54,575,957		probably benign	Het
Armc3	A	G	2: 19,296,321		probably null	Het
Astn2	T	G	4: 66,266,382		probably null	Het
Cacna1d	G	A	14: 30,114,971	T804I	probably benign	Het
Ccny	A	C	18: 9,316,682		probably benign	Het
Cdh5	C	T	8: 104,140,927	T612I	probably benign	Het
Cfap58	A	G	19: 48,029,100	M800V	probably benign	Het
Clrn1	A	T	3: 58,846,427	I171K	probably damaging	Het
Cnp	T	A	11: 100,578,908		probably null	Het
Col12a1	T	C	9: 79,651,385	T1933A	probably damaging	Het
Cwf19l2	A	G	9: 3,454,666	S660G	probably benign	Het
Dync1i2	C	A	2: 71,214,484	R13S	probably damaging	Het
Eps8l1	A	T	7: 4,477,557		probably benign	Het
Espn	T	C	4: 152,139,152	T188A	possibly damaging	Het
F2	T	C	2: 91,630,607	E260G	probably benign	Het
Fat4	T	A	3: 38,982,503	S3435T	probably damaging	Het
Fchsd1	A	G	18: 37,962,959	C533R	probably benign	Het
Fstl5	G	A	3: 76,322,191	V100M	probably damaging	Het
Gls2	T	G	10: 128,209,350	L572R	probably damaging	Het
Gm20939	A	T	17: 94,876,768	E281D	probably benign	Het
Gpr35	T	G	1: 92,983,232	L222W	probably damaging	Het
Hsf5	C	A	11: 87,657,335	H615N	probably benign	Het
Id2	C	T	12: 25,095,803	D70N	probably damaging	Het
Ints2	T	C	11: 86,249,287	T240A	probably damaging	Het
Kcnn3	A	C	3: 89,662,773	D631A	probably damaging	Het
Klhdc8a	A	G	1: 132,303,005	T203A	probably damaging	Het
Lama4	C	T	10: 39,075,436	T1059M	possibly damaging	Het
Lgals8	A	G	13: 12,447,298	L226P	probably damaging	Het
Lifr	T	A	15: 7,188,186		probably null	Het
Lonp1	T	A	17: 56,618,406	Q462L	probably benign	Het
Lypd1	A	G	1: 125,910,438	V48A	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,326	I67T	possibly damaging	Het
Mbd3l1	A	T	9: 18,484,858	D93V	probably benign	Het
Mdh1b	T	C	1: 63,721,800		probably benign	Het
Myh7b	C	T	2: 155,622,286	P569L	probably damaging	Het
Ndrg2	A	G	14: 51,910,445		probably benign	Het
Nprl2	A	T	9: 107,544,419	I209F	probably damaging	Het
Ntrk1	A	G	3: 87,791,750		probably benign	Het
Olfm2	T	C	9: 20,668,741	E268G	probably damaging	Het
Olfr884	T	A	9: 38,047,667	Y148*	probably null	Het
Pcf11	T	A	7: 92,658,317	H881L	probably benign	Het
Pde10a	A	G	17: 8,977,197	D640G	probably damaging	Het
Pde9a	G	A	17: 31,386,356		probably null	Het
Pianp	G	T	6: 125,001,540	G236V	probably damaging	Het
Polr2g	A	G	19: 8,793,652	I160T	probably damaging	Het
Ppp1r3a	A	G	6: 14,717,661	S1085P	possibly damaging	Het
Pter	G	A	2: 13,001,000	G328D	probably damaging	Het
Rad51	T	A	2: 119,116,327	M5K	probably benign	Het
Rbm43	T	A	2: 51,925,667	I181F	probably benign	Het
Rgs12	T	C	5: 35,022,776		probably benign	Het
Rnf213	A	C	11: 119,441,606	D2547A	possibly damaging	Het
Slc20a2	C	A	8: 22,535,345	A21E	probably damaging	Het
Stab2	A	G	10: 86,843,617	S2503P	probably benign	Het
Sv2b	A	T	7: 75,125,641	F479L	probably damaging	Het
Sybu	T	C	15: 44,673,500	R349G	probably damaging	Het
Tead3	T	C	17: 28,341,351	Y2C	probably damaging	Het
Tnrc6c	T	A	11: 117,721,458	N307K	probably damaging	Het
Ubxn11	C	G	4: 134,116,025		probably null	Het
Ust	T	C	10: 8,330,065		probably benign	Het
Vmn2r116	T	A	17: 23,401,849	N852K	probably benign	Het
Zgrf1	T	C	3: 127,555,397		probably benign	Het

Other mutations in Ncapd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Ncapd3	APN	9	27052353	missense	probably benign
IGL00544:Ncapd3	APN	9	27063338	missense	possibly damaging	0.94
IGL01657:Ncapd3	APN	9	27071824	missense	possibly damaging	0.81
IGL01979:Ncapd3	APN	9	27071965	critical splice donor site	probably null
IGL02073:Ncapd3	APN	9	27063316	missense	probably benign	0.03
IGL02083:Ncapd3	APN	9	27051821	missense	probably damaging	1.00
IGL02383:Ncapd3	APN	9	27050328	missense	probably benign	0.44
IGL02429:Ncapd3	APN	9	27089302	missense	probably benign	0.08
IGL02437:Ncapd3	APN	9	27063968	splice site	probably benign
IGL02861:Ncapd3	APN	9	27069899	missense	probably benign	0.00
IGL03202:Ncapd3	APN	9	27071715	splice site	probably benign
IGL03219:Ncapd3	APN	9	27063873	splice site	probably benign
IGL03252:Ncapd3	APN	9	27051449	missense	probably damaging	1.00
pevensie	UTSW	9	27086046	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0084:Ncapd3	UTSW	9	27056111	missense	probably damaging	0.98
R0491:Ncapd3	UTSW	9	27057883	missense	probably damaging	0.97
R0513:Ncapd3	UTSW	9	27064105	splice site	probably benign
R0565:Ncapd3	UTSW	9	27087998	missense	probably benign	0.00
R0601:Ncapd3	UTSW	9	27041507	missense	probably benign	0.05
R0671:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0673:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0842:Ncapd3	UTSW	9	27037084	missense	probably benign	0.01
R1178:Ncapd3	UTSW	9	27041421	missense	probably benign
R1366:Ncapd3	UTSW	9	27057940	missense	probably damaging	1.00
R1432:Ncapd3	UTSW	9	27069872	splice site	probably benign
R1439:Ncapd3	UTSW	9	27087566	critical splice donor site	probably null
R1532:Ncapd3	UTSW	9	27083360	nonsense	probably null
R2131:Ncapd3	UTSW	9	27083346	missense	probably damaging	0.98
R2178:Ncapd3	UTSW	9	27088549	missense	probably benign	0.01
R2238:Ncapd3	UTSW	9	27067024	missense	probably benign
R2258:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2259:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2260:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2297:Ncapd3	UTSW	9	27041501	nonsense	probably null
R2877:Ncapd3	UTSW	9	27044487	splice site	probably null
R3612:Ncapd3	UTSW	9	27050357	missense	probably damaging	1.00
R3709:Ncapd3	UTSW	9	27052349	missense	probably benign	0.00
R3791:Ncapd3	UTSW	9	27052635	missense	probably benign	0.27
R4052:Ncapd3	UTSW	9	27089383	splice site	probably null
R4297:Ncapd3	UTSW	9	27052327	missense	probably benign
R4299:Ncapd3	UTSW	9	27052327	missense	probably benign
R4441:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R4572:Ncapd3	UTSW	9	27094615	missense	probably damaging	1.00
R4675:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R4790:Ncapd3	UTSW	9	27051850	missense	probably benign	0.00
R4835:Ncapd3	UTSW	9	27086046	missense	probably damaging	1.00
R4919:Ncapd3	UTSW	9	27051775	missense	possibly damaging	0.95
R4928:Ncapd3	UTSW	9	27071735	nonsense	probably null
R4939:Ncapd3	UTSW	9	27063869	critical splice donor site	probably null
R4980:Ncapd3	UTSW	9	27063295	missense	probably damaging	0.99
R5030:Ncapd3	UTSW	9	27071766	missense	probably damaging	0.98
R5052:Ncapd3	UTSW	9	27051719	missense	probably damaging	1.00
R5180:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5343:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R5656:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5840:Ncapd3	UTSW	9	27094758	missense	probably benign	0.00
R5900:Ncapd3	UTSW	9	27066969	missense	probably benign	0.26
R6093:Ncapd3	UTSW	9	27056158	missense	probably damaging	0.99
R6122:Ncapd3	UTSW	9	27063982	missense	probably benign	0.00
R6249:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R6428:Ncapd3	UTSW	9	27052664	splice site	probably null
R6432:Ncapd3	UTSW	9	27044509	missense	probably damaging	0.98
R6441:Ncapd3	UTSW	9	27063416	missense	probably benign	0.03
R6459:Ncapd3	UTSW	9	27051755	missense	probably benign	0.00
R6567:Ncapd3	UTSW	9	27067004	missense	possibly damaging	0.83
R6722:Ncapd3	UTSW	9	27087556	missense	probably benign
R6862:Ncapd3	UTSW	9	27030809	missense	probably damaging	0.98
R7234:Ncapd3	UTSW	9	27050359	missense	probably damaging	0.97
R7286:Ncapd3	UTSW	9	27069958	missense	probably damaging	1.00
R7404:Ncapd3	UTSW	9	27067019	missense	probably benign	0.01
R7541:Ncapd3	UTSW	9	27067040	missense	probably damaging	0.99
R7583:Ncapd3	UTSW	9	27071848	missense	probably damaging	1.00
R7655:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7656:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7815:Ncapd3	UTSW	9	27063440	nonsense	probably null
R7876:Ncapd3	UTSW	9	27045223	critical splice donor site	probably null
R7913:Ncapd3	UTSW	9	27048226	nonsense	probably null
R8068:Ncapd3	UTSW	9	27063361	missense	possibly damaging	0.66
R8147:Ncapd3	UTSW	9	27030718	start gained	probably benign
R8197:Ncapd3	UTSW	9	27086033	missense	probably damaging	0.98
R8264:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R8353:Ncapd3	UTSW	9	27071804	missense	probably benign	0.03
R8539:Ncapd3	UTSW	9	27048224	missense	probably benign
R8839:Ncapd3	UTSW	9	27094434	missense
R8917:Ncapd3	UTSW	9	27088001	missense	probably benign
R8997:Ncapd3	UTSW	9	27048281	missense	probably damaging	1.00
R9215:Ncapd3	UTSW	9	27064090	missense	possibly damaging	0.51
R9393:Ncapd3	UTSW	9	27051386	missense	possibly damaging	0.54
R9412:Ncapd3	UTSW	9	27056155	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACTGTCTGATGGCAGCCAGAG -3'
(R):5'- ATACATGCACAGCGGTGTGAGG -3'

Sequencing Primer
(F):5'- AGATTCCACACCGGGTCTTC -3'
(R):5'- TGTACCCTTAACAAAGAATGGTCC -3'

Posted On

2013-08-06