Incidental Mutation 'R0015:Ncapd3'
ID64903
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Namenon-SMC condensin II complex, subunit D3
Synonyms4632407J06Rik, B130055D15Rik, 2810487N22Rik
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0015 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27030175-27095315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27051809 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 470 (A470E)
Ref Sequence ENSEMBL: ENSMUSP00000083374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073127
AA Change: A470E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: A470E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086198
AA Change: A470E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: A470E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000216677
AA Change: A470E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217311
Meta Mutation Damage Score 0.7204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 27052353 missense probably benign
IGL00544:Ncapd3 APN 9 27063338 missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 27071824 missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 27071965 critical splice donor site probably null
IGL02073:Ncapd3 APN 9 27063316 missense probably benign 0.03
IGL02083:Ncapd3 APN 9 27051821 missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 27050328 missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27089302 missense probably benign 0.08
IGL02437:Ncapd3 APN 9 27063968 splice site probably benign
IGL02861:Ncapd3 APN 9 27069899 missense probably benign 0.00
IGL03202:Ncapd3 APN 9 27071715 splice site probably benign
IGL03219:Ncapd3 APN 9 27063873 splice site probably benign
IGL03252:Ncapd3 APN 9 27051449 missense probably damaging 1.00
pevensie UTSW 9 27086046 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 27056111 missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 27057883 missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 27064105 splice site probably benign
R0565:Ncapd3 UTSW 9 27087998 missense probably benign 0.00
R0601:Ncapd3 UTSW 9 27041507 missense probably benign 0.05
R0671:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0673:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0842:Ncapd3 UTSW 9 27037084 missense probably benign 0.01
R1178:Ncapd3 UTSW 9 27041421 missense probably benign
R1366:Ncapd3 UTSW 9 27057940 missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 27069872 splice site probably benign
R1439:Ncapd3 UTSW 9 27087566 critical splice donor site probably null
R1532:Ncapd3 UTSW 9 27083360 nonsense probably null
R2131:Ncapd3 UTSW 9 27083346 missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 27088549 missense probably benign 0.01
R2238:Ncapd3 UTSW 9 27067024 missense probably benign
R2258:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2259:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2260:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2297:Ncapd3 UTSW 9 27041501 nonsense probably null
R2877:Ncapd3 UTSW 9 27044487 splice site probably null
R3612:Ncapd3 UTSW 9 27050357 missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 27052349 missense probably benign 0.00
R3791:Ncapd3 UTSW 9 27052635 missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27089383 splice site probably null
R4297:Ncapd3 UTSW 9 27052327 missense probably benign
R4299:Ncapd3 UTSW 9 27052327 missense probably benign
R4441:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27094615 missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27094742 unclassified probably benign
R4790:Ncapd3 UTSW 9 27051850 missense probably benign 0.00
R4835:Ncapd3 UTSW 9 27086046 missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 27051775 missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 27071735 nonsense probably null
R4939:Ncapd3 UTSW 9 27063869 critical splice donor site probably null
R4980:Ncapd3 UTSW 9 27063295 missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 27071766 missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 27051719 missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 27088053 small deletion probably benign
R5656:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27094758 missense probably benign 0.00
R5900:Ncapd3 UTSW 9 27066969 missense probably benign 0.26
R6093:Ncapd3 UTSW 9 27056158 missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 27063982 missense probably benign 0.00
R6249:Ncapd3 UTSW 9 27088053 small deletion probably benign
R6428:Ncapd3 UTSW 9 27052664 splice site probably null
R6432:Ncapd3 UTSW 9 27044509 missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 27063416 missense probably benign 0.03
R6459:Ncapd3 UTSW 9 27051755 missense probably benign 0.00
R6567:Ncapd3 UTSW 9 27067004 missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 27087556 missense probably benign
R6862:Ncapd3 UTSW 9 27030809 missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 27050359 missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 27069958 missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 27067019 missense probably benign 0.01
R7541:Ncapd3 UTSW 9 27067040 missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 27071848 missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTGACTGTCTGATGGCAGCCAGAG -3'
(R):5'- ATACATGCACAGCGGTGTGAGG -3'

Sequencing Primer
(F):5'- AGATTCCACACCGGGTCTTC -3'
(R):5'- TGTACCCTTAACAAAGAATGGTCC -3'
Posted On2013-08-06