Mutagenetix > Incidental Mutation

Incidental Mutation 'R7941:Cenpf'

649035

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.560) question?

Stock #

R7941 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 189657286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1450 (S1450P)

Ref Sequence

ENSEMBL: ENSMUSP00000129738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000165962

SMART Domains

Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	7.3e-135	PFAM
low complexity region	332	347	N/A	INTRINSIC
low complexity region	361	379	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	572	592	N/A	INTRINSIC
internal_repeat_1	737	759	3.18e-5	PROSPERO
internal_repeat_1	751	773	3.18e-5	PROSPERO
internal_repeat_2	789	804	5.94e-5	PROSPERO
coiled coil region	812	864	N/A	INTRINSIC
coiled coil region	885	923	N/A	INTRINSIC
low complexity region	925	936	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171929
AA Change: S1450P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: S1450P

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl1	T	C	2: 31,689,679		probably benign	Het
AI467606	A	G	7: 127,092,421	E56G	probably damaging	Het
Ak9	C	T	10: 41,409,137	P1403S	unknown	Het
Akr1c14	A	G	13: 4,059,713	K28E	probably benign	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Anks1b	A	T	10: 90,577,155	N55I	probably damaging	Het
C87414	A	T	5: 93,638,028	V131D	probably benign	Het
Cabyr	T	C	18: 12,744,768	L54P	probably damaging	Het
Cachd1	A	T	4: 100,988,173	N954I	probably damaging	Het
Chst10	T	A	1: 38,871,691	I131L	probably damaging	Het
Cluh	A	T	11: 74,659,757	M270L	probably benign	Het
Dagla	T	C	19: 10,271,503	H29R	probably damaging	Het
Dusp5	A	G	19: 53,537,533	N202S	probably benign	Het
Elavl3	A	G	9: 22,036,316	I110T	possibly damaging	Het
Fam222b	G	T	11: 78,155,059	G482V	possibly damaging	Het
Fbxl7	A	G	15: 26,543,613	L316P	probably damaging	Het
Gad1	T	A	2: 70,594,585		probably null	Het
H2-K1	T	C	17: 33,999,331	T204A	probably benign	Het
Hmcn1	A	G	1: 150,650,084	V3296A	possibly damaging	Het
Hyal1	T	C	9: 107,578,100	F203S	probably damaging	Het
Il16	T	A	7: 83,682,829	D181V	probably damaging	Het
Ip6k1	T	C	9: 108,024,432	F69L	probably damaging	Het
Klf4	G	A	4: 55,531,755		probably benign	Het
Lsr	T	G	7: 30,973,095	I27L	probably benign	Het
Mettl4	A	T	17: 94,733,194		probably null	Het
Mpdz	A	G	4: 81,282,750	V1902A	probably benign	Het
Nfkbiz	C	T	16: 55,821,944	G37D	probably damaging	Het
Olfr1131	T	C	2: 87,628,904	V31A	probably benign	Het
Otogl	A	T	10: 107,806,802		probably null	Het
Pcdh1	T	C	18: 38,199,080	D429G	probably damaging	Het
Prelid2	A	T	18: 41,932,751	L73*	probably null	Het
Psg20	T	A	7: 18,681,177		probably null	Het
Ptprb	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,677		probably benign	Het
Rab24	C	T	13: 55,320,307		probably null	Het
Rag1	T	G	2: 101,642,346	K817T	probably benign	Het
Rgl2	T	C	17: 33,931,739	V57A	probably benign	Het
Ric1	T	C	19: 29,533,259	M80T	probably damaging	Het
Sh3rf3	T	C	10: 59,007,061	I283T	probably damaging	Het
Skint2	C	A	4: 112,625,990	N197K	probably damaging	Het
Snapc4	A	G	2: 26,376,718	I126T	probably damaging	Het
Srcap	GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	7: 127,558,290		probably benign	Het
Svip	T	C	7: 52,003,413	K51R	probably benign	Het
Syndig1	T	A	2: 149,899,788	V98E	probably benign	Het
Tshz1	A	T	18: 84,015,392	M297K	possibly damaging	Het
Ttn	A	G	2: 76,919,350	V3785A	probably benign	Het
Usf3	T	C	16: 44,215,561	S135P	probably damaging	Het
Vmn2r10	A	T	5: 108,996,440	M548K	probably damaging	Het
Vmn2r92	T	C	17: 18,184,837	S748P	possibly damaging	Het
Zbtb39	A	G	10: 127,743,540	Y661C	probably damaging	Het
Zfp804b	A	G	5: 6,770,042	I1007T	probably benign	Het
Zscan4-ps2	A	G	7: 11,517,672	I212V	probably benign	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4119:Cenpf	UTSW	1	189653045	missense	probably benign	0.01
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5468:Cenpf	UTSW	1	189652371	missense	probably damaging	1.00
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7353:Cenpf	UTSW	1	189654138	nonsense	probably null
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
R7901:Cenpf	UTSW	1	189657248	missense	probably damaging	1.00
R8007:Cenpf	UTSW	1	189646947	missense
R8194:Cenpf	UTSW	1	189682403	missense	probably benign	0.06
R8420:Cenpf	UTSW	1	189672585	missense	probably damaging	1.00
R8429:Cenpf	UTSW	1	189657307	missense	possibly damaging	0.72
R8477:Cenpf	UTSW	1	189653188	missense	probably benign
R8492:Cenpf	UTSW	1	189658729	missense	probably damaging	0.99
R8510:Cenpf	UTSW	1	189650706	missense	probably benign	0.01
R8686:Cenpf	UTSW	1	189659604	missense	probably benign	0.00
R8696:Cenpf	UTSW	1	189657997	missense	probably benign	0.20
R8855:Cenpf	UTSW	1	189653233	missense	probably benign	0.11
R8901:Cenpf	UTSW	1	189662051	missense	probably benign	0.30
R8958:Cenpf	UTSW	1	189653153	missense	possibly damaging	0.81
R9109:Cenpf	UTSW	1	189659374	missense	probably benign	0.06
R9135:Cenpf	UTSW	1	189672549	missense	probably damaging	1.00
R9136:Cenpf	UTSW	1	189671155	missense	probably benign	0.02
R9198:Cenpf	UTSW	1	189656790	missense	probably damaging	1.00
R9240:Cenpf	UTSW	1	189656970	missense	probably benign	0.01
R9303:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9305:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9354:Cenpf	UTSW	1	189646917	missense
R9502:Cenpf	UTSW	1	189656781	missense	probably damaging	1.00
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00
Z1176:Cenpf	UTSW	1	189659472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAAGCGTTCCCTTCTAAAC -3'
(R):5'- ACTCCTTTGGACAGTAGCAATTTC -3'

Sequencing Primer
(F):5'- ACTTAGATGACATGTGTCTCCAG -3'
(R):5'- CTGTGAACAGATGACCTTGTCAAGC -3'

Posted On

2020-09-15