Incidental Mutation 'R7941:Olfr1131'
ID 649039
Institutional Source Beutler Lab
Gene Symbol Olfr1131
Ensembl Gene ENSMUSG00000068819
Gene Name olfactory receptor 1131
Synonyms GA_x6K02T2Q125-49133664-49134593, MOR177-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7941 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87627104-87630203 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87628904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000148881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
AlphaFold Q7TR45
Predicted Effect probably benign
Transcript: ENSMUST00000090712
AA Change: V147A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: V147A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213302
AA Change: V147A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably benign
Transcript: ENSMUST00000216756
AA Change: V31A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Olfr1131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr1131 APN 2 87628629 missense probably benign 0.03
IGL02186:Olfr1131 APN 2 87629371 missense probably benign 0.00
R0266:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R0849:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R1607:Olfr1131 UTSW 2 87628977 missense probably benign 0.14
R2077:Olfr1131 UTSW 2 87628829 missense probably damaging 1.00
R2105:Olfr1131 UTSW 2 87628939 missense probably benign 0.20
R2322:Olfr1131 UTSW 2 87628774 missense possibly damaging 0.86
R3434:Olfr1131 UTSW 2 87629074 missense probably benign 0.02
R4357:Olfr1131 UTSW 2 87628466 start codon destroyed probably null 1.00
R5139:Olfr1131 UTSW 2 87628656 missense probably benign 0.03
R5333:Olfr1131 UTSW 2 87629114 missense probably damaging 0.97
R5719:Olfr1131 UTSW 2 87629131 splice site probably null
R6449:Olfr1131 UTSW 2 87629149 missense possibly damaging 0.63
R7640:Olfr1131 UTSW 2 87629092 missense probably benign 0.01
R8110:Olfr1131 UTSW 2 87628607 missense possibly damaging 0.75
R8393:Olfr1131 UTSW 2 87628853 missense probably damaging 0.97
R8877:Olfr1131 UTSW 2 87628868 missense probably damaging 1.00
R9250:Olfr1131 UTSW 2 87628934 missense probably benign 0.02
R9290:Olfr1131 UTSW 2 87628865 missense probably benign 0.00
R9313:Olfr1131 UTSW 2 87628732 missense probably benign 0.03
X0027:Olfr1131 UTSW 2 87629303 missense possibly damaging 0.96
Z1176:Olfr1131 UTSW 2 87629315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTGGTCCCAAGATGCTGC -3'
(R):5'- GTGCTCAGTTCAAGGAAGCC -3'

Sequencing Primer
(F):5'- GTCCCAAGATGCTGCTAGATATG -3'
(R):5'- CTCAGTTCAAGGAAGCCATAAATAG -3'
Posted On 2020-09-15