Incidental Mutation 'R7941:Syndig1'
ID649041
Institutional Source Beutler Lab
Gene Symbol Syndig1
Ensembl Gene ENSMUSG00000074736
Gene Namesynapse differentiation inducing 1
SynonymsTmem90b, SynDIG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location149829211-150004392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149899788 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 98 (V98E)
Ref Sequence ENSEMBL: ENSMUSP00000122327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109934] [ENSMUST00000109935] [ENSMUST00000137280] [ENSMUST00000140870] [ENSMUST00000144179] [ENSMUST00000149705]
Predicted Effect probably benign
Transcript: ENSMUST00000109934
AA Change: V98E

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105560
Gene: ENSMUSG00000074736
AA Change: V98E

DomainStartEndE-ValueType
Pfam:Dispanin 164 246 5.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109935
AA Change: V98E

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105561
Gene: ENSMUSG00000074736
AA Change: V98E

DomainStartEndE-ValueType
low complexity region 151 171 N/A INTRINSIC
Pfam:CD225 172 244 7.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137280
Predicted Effect probably benign
Transcript: ENSMUST00000140870
Predicted Effect probably benign
Transcript: ENSMUST00000144179
Predicted Effect probably benign
Transcript: ENSMUST00000149705
AA Change: V98E

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the interferon-induced transmembrane family of proteins. A similar protein in rat is thought to regulate the development of excitatory synapses. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Syndig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Syndig1 APN 2 149899757 missense probably damaging 1.00
IGL01599:Syndig1 APN 2 150003283 missense probably damaging 1.00
IGL01814:Syndig1 APN 2 149899770 missense probably damaging 1.00
IGL01988:Syndig1 APN 2 150003170 splice site probably benign
IGL02323:Syndig1 APN 2 149899787 missense probably benign 0.00
R1445:Syndig1 UTSW 2 149930921 missense probably damaging 1.00
R1523:Syndig1 UTSW 2 150003234 missense probably damaging 1.00
R4825:Syndig1 UTSW 2 149899553 missense probably damaging 0.99
R4892:Syndig1 UTSW 2 149899891 missense probably damaging 1.00
R5643:Syndig1 UTSW 2 149899508 missense possibly damaging 0.78
R5644:Syndig1 UTSW 2 149899508 missense possibly damaging 0.78
R6386:Syndig1 UTSW 2 149899576 missense probably damaging 1.00
R6603:Syndig1 UTSW 2 150003288 missense probably damaging 1.00
R8177:Syndig1 UTSW 2 149899868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAACTTCATGGCTGAGAG -3'
(R):5'- TGACCTCCAGCTCCTGTAAC -3'

Sequencing Primer
(F):5'- CTGAGAGCAGGGATGGTCTG -3'
(R):5'- TCCAGCTCCTGTAACTCCTC -3'
Posted On2020-09-15