Incidental Mutation 'R7941:Ampd2'
ID649042
Institutional Source Beutler Lab
Gene Symbol Ampd2
Ensembl Gene ENSMUSG00000027889
Gene Nameadenosine monophosphate deaminase 2
Synonyms1200014F01Rik, Ampd-2
MMRRC Submission
Accession Numbers

Genbank: NM_028779; MGI: 88016

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108074062-108086651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108080116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 134 (V134L)
Ref Sequence ENSEMBL: ENSMUSP00000099698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078912] [ENSMUST00000102637] [ENSMUST00000102638]
Predicted Effect probably benign
Transcript: ENSMUST00000078912
AA Change: V160L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077946
Gene: ENSMUSG00000027889
AA Change: V160L

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 357 764 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102637
AA Change: V134L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099697
Gene: ENSMUSG00000027889
AA Change: V134L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102638
AA Change: V134L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099698
Gene: ENSMUSG00000027889
AA Change: V134L

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit proteinuria, tubules filled with protein casts and podocyte process effacement. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Ampd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ampd2 APN 3 108077396 missense probably damaging 1.00
IGL02142:Ampd2 APN 3 108080344 splice site probably benign
IGL02174:Ampd2 APN 3 108080285 missense probably damaging 0.96
IGL02686:Ampd2 APN 3 108076495 missense possibly damaging 0.62
IGL03326:Ampd2 APN 3 108079287 missense probably benign 0.02
IGL03493:Ampd2 APN 3 108075358 missense probably damaging 1.00
D4186:Ampd2 UTSW 3 108081111 missense probably benign 0.00
H8562:Ampd2 UTSW 3 108081111 missense probably benign 0.00
PIT4445001:Ampd2 UTSW 3 108075012 missense probably damaging 1.00
R0271:Ampd2 UTSW 3 108086716 unclassified probably benign
R0835:Ampd2 UTSW 3 108076502 missense possibly damaging 0.48
R0975:Ampd2 UTSW 3 108077121 missense probably damaging 1.00
R1061:Ampd2 UTSW 3 108075689 missense probably damaging 1.00
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1584:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R2034:Ampd2 UTSW 3 108077363 missense possibly damaging 0.91
R2164:Ampd2 UTSW 3 108085369 intron probably benign
R3040:Ampd2 UTSW 3 108076416 missense probably damaging 1.00
R3052:Ampd2 UTSW 3 108086487 utr 5 prime probably benign
R4329:Ampd2 UTSW 3 108077787 intron probably benign
R4425:Ampd2 UTSW 3 108086736 unclassified probably benign
R5073:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5074:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5180:Ampd2 UTSW 3 108079042 missense probably benign 0.00
R5256:Ampd2 UTSW 3 108079549 intron probably benign
R5507:Ampd2 UTSW 3 108077613 missense probably damaging 1.00
R5513:Ampd2 UTSW 3 108075667 missense possibly damaging 0.85
R5955:Ampd2 UTSW 3 108079772 missense probably damaging 1.00
R6941:Ampd2 UTSW 3 108079293 missense probably damaging 0.99
R7744:Ampd2 UTSW 3 108080116 missense probably benign
R7745:Ampd2 UTSW 3 108080116 missense probably benign
R7815:Ampd2 UTSW 3 108074931 missense probably benign 0.06
R7938:Ampd2 UTSW 3 108080116 missense probably benign
R7939:Ampd2 UTSW 3 108080116 missense probably benign
R7942:Ampd2 UTSW 3 108080116 missense probably benign
R8309:Ampd2 UTSW 3 108080116 missense probably benign
R8312:Ampd2 UTSW 3 108080116 missense probably benign
R8503:Ampd2 UTSW 3 108080116 missense probably benign
R8518:Ampd2 UTSW 3 108080116 missense probably benign
Z1176:Ampd2 UTSW 3 108080064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAACATCCAGCCTTCTC -3'
(R):5'- TTTCCTGAAGACAGACAGCG -3'

Sequencing Primer
(F):5'- TCTGGTCCCAGAGAATCAGTG -3'
(R):5'- CAGCGACTCAGACTTACAGTAAGG -3'
Posted On2020-09-15