Incidental Mutation 'R7941:Klf4'
ID649043
Institutional Source Beutler Lab
Gene Symbol Klf4
Ensembl Gene ENSMUSG00000003032
Gene NameKruppel-like factor 4 (gut)
SynonymsZie, EZF, Gklf
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location55527143-55532466 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 55531755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107619] [ENSMUST00000129250] [ENSMUST00000132746]
Predicted Effect probably benign
Transcript: ENSMUST00000107619
SMART Domains Protein: ENSMUSP00000103245
Gene: ENSMUSG00000003032

DomainStartEndE-ValueType
low complexity region 116 144 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
ZnF_C2H2 400 424 1.82e-3 SMART
ZnF_C2H2 430 454 4.3e-5 SMART
ZnF_C2H2 460 482 8.47e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129250
SMART Domains Protein: ENSMUSP00000116514
Gene: ENSMUSG00000003032

DomainStartEndE-ValueType
low complexity region 107 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132746
SMART Domains Protein: ENSMUSP00000123687
Gene: ENSMUSG00000003032

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth due to a skin defect that results in loss of fluids. Mutants also show a dramatic decrease in the number of goblet cells of the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Klf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Klf4 APN 4 55530949 missense probably benign 0.14
IGL02602:Klf4 APN 4 55530595 missense probably damaging 0.99
IGL03088:Klf4 APN 4 55530758 missense possibly damaging 0.52
IGL03088:Klf4 APN 4 55530811 missense probably damaging 1.00
IGL03185:Klf4 APN 4 55530911 missense possibly damaging 0.65
R0846:Klf4 UTSW 4 55530191 missense probably damaging 0.99
R1815:Klf4 UTSW 4 55530977 missense probably benign 0.24
R1816:Klf4 UTSW 4 55530977 missense probably benign 0.24
R4180:Klf4 UTSW 4 55530884 missense possibly damaging 0.96
R4625:Klf4 UTSW 4 55530370 missense probably benign 0.39
R4993:Klf4 UTSW 4 55530640 missense probably damaging 1.00
R5021:Klf4 UTSW 4 55530970 missense probably damaging 1.00
R5033:Klf4 UTSW 4 55530301 missense probably benign 0.23
R5113:Klf4 UTSW 4 55530481 missense possibly damaging 0.94
R6569:Klf4 UTSW 4 55530394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAATGGAGGGCAATCC -3'
(R):5'- TGACTTTGGGGCTCAGGTAC -3'

Sequencing Primer
(F):5'- AAGGACTCTTGGTGACCCC -3'
(R):5'- GGCTCAGGTACCCCTCTC -3'
Posted On2020-09-15