Incidental Mutation 'R7941:Skint2'
ID649046
Institutional Source Beutler Lab
Gene Symbol Skint2
Ensembl Gene ENSMUSG00000034359
Gene Nameselection and upkeep of intraepithelial T cells 2
SynonymsB7S3, OTTMUSG00000008540
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112557194-112652248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112625990 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 197 (N197K)
Ref Sequence ENSEMBL: ENSMUSP00000139831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058791] [ENSMUST00000106560] [ENSMUST00000186969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058791
AA Change: N197K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061011
Gene: ENSMUSG00000034359
AA Change: N197K

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 140 225 2.7e-10 PFAM
Pfam:Ig_2 153 231 3.6e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106560
AA Change: N197K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102170
Gene: ENSMUSG00000034359
AA Change: N197K

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 1.3e-10 PFAM
Pfam:Ig_2 153 231 2e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186969
AA Change: N197K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139831
Gene: ENSMUSG00000034359
AA Change: N197K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 2e-10 PFAM
Pfam:Ig_2 154 231 1.7e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 322 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Skint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Skint2 APN 4 112624212 missense probably damaging 1.00
IGL00801:Skint2 APN 4 112625991 missense possibly damaging 0.88
IGL01602:Skint2 APN 4 112625994 missense probably benign 0.44
IGL01605:Skint2 APN 4 112625994 missense probably benign 0.44
IGL02015:Skint2 APN 4 112624128 nonsense probably null
IGL02694:Skint2 APN 4 112616595 splice site probably benign
IGL03247:Skint2 APN 4 112626026 missense probably benign 0.06
PIT4677001:Skint2 UTSW 4 112625938 missense probably benign 0.10
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0190:Skint2 UTSW 4 112616532 missense possibly damaging 0.85
R0479:Skint2 UTSW 4 112624041 missense possibly damaging 0.47
R0625:Skint2 UTSW 4 112624086 missense probably damaging 1.00
R1143:Skint2 UTSW 4 112625936 missense probably benign 0.00
R1564:Skint2 UTSW 4 112625998 missense probably damaging 1.00
R1861:Skint2 UTSW 4 112647118 intron probably benign
R1864:Skint2 UTSW 4 112625909 missense probably benign 0.10
R3079:Skint2 UTSW 4 112639673 missense probably benign 0.01
R3891:Skint2 UTSW 4 112624186 missense probably damaging 1.00
R4422:Skint2 UTSW 4 112584588 intron probably benign
R4799:Skint2 UTSW 4 112652108 missense probably benign 0.07
R5458:Skint2 UTSW 4 112624180 missense possibly damaging 0.83
R5482:Skint2 UTSW 4 112625879 missense probably damaging 1.00
R5603:Skint2 UTSW 4 112649764 missense possibly damaging 0.91
R7068:Skint2 UTSW 4 112624351 missense probably damaging 1.00
R7233:Skint2 UTSW 4 112625925 missense probably damaging 0.99
R7335:Skint2 UTSW 4 112624218 missense probably damaging 1.00
R7516:Skint2 UTSW 4 112625971 missense probably damaging 1.00
R7790:Skint2 UTSW 4 112616554 missense possibly damaging 0.71
R7878:Skint2 UTSW 4 112649745 missense possibly damaging 0.85
R7965:Skint2 UTSW 4 112645451 missense probably benign 0.17
R7976:Skint2 UTSW 4 112624132 missense probably damaging 1.00
R8100:Skint2 UTSW 4 112626000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAACCAGGGTCCTGTAGAC -3'
(R):5'- CTTTATAAACCAAGTCAAGGAAGAAGC -3'

Sequencing Primer
(F):5'- AACCAGGGTCCTGTAGACTTTTTGAC -3'
(R):5'- CCAAGTCAAGGAAGAAGCTAATAAC -3'
Posted On2020-09-15