Incidental Mutation 'R7941:Zfp804b'
ID649047
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6770042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1007 (I1007T)
Ref Sequence ENSEMBL: ENSMUSP00000143568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000164784
AA Change: I971T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: I971T

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: I1007T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: I1007T

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
R7574:Zfp804b UTSW 5 6772301 missense possibly damaging 0.74
R7609:Zfp804b UTSW 5 6770066 missense possibly damaging 0.90
R7654:Zfp804b UTSW 5 6769458 missense probably damaging 0.97
R7669:Zfp804b UTSW 5 6769362 missense probably damaging 1.00
R7717:Zfp804b UTSW 5 6771293 missense possibly damaging 0.50
R7721:Zfp804b UTSW 5 6771263 missense possibly damaging 0.55
R7830:Zfp804b UTSW 5 6771124 missense probably benign
R7937:Zfp804b UTSW 5 6771866 missense possibly damaging 0.49
R8093:Zfp804b UTSW 5 6770082 missense probably benign 0.02
R8275:Zfp804b UTSW 5 6772289 missense probably benign 0.00
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAAATCATTTGGTACTGGGTC -3'
(R):5'- AGTGTCAGGAGCAATCAACG -3'

Sequencing Primer
(F):5'- GAAATCATTTGGTACTGGGTCATAGC -3'
(R):5'- GTTCGAAATCTCCTCAAACAGTTG -3'
Posted On2020-09-15