Incidental Mutation 'R7941:C87414'
ID649048
Institutional Source Beutler Lab
Gene Symbol C87414
Ensembl Gene ENSMUSG00000070686
Gene Nameexpressed sequence C87414
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7941 (G1)
Quality Score107.008
Status Not validated
Chromosome5
Chromosomal Location93634993-93671551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93638028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 131 (V131D)
Ref Sequence ENSEMBL: ENSMUSP00000124780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076321] [ENSMUST00000159578] [ENSMUST00000160382] [ENSMUST00000162964]
Predicted Effect probably benign
Transcript: ENSMUST00000076321
SMART Domains Protein: ENSMUSP00000075662
Gene: ENSMUSG00000070686

DomainStartEndE-ValueType
SCOP:d1a4ya_ 67 191 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159578
AA Change: V131D

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000160382
AA Change: V131D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000162964
AA Change: V131D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124780
Gene: ENSMUSG00000070686
AA Change: V131D

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 1e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in C87414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:C87414 APN 5 93636477 missense probably damaging 1.00
IGL01642:C87414 APN 5 93636295 missense possibly damaging 0.84
IGL02735:C87414 APN 5 93638644 missense possibly damaging 0.94
PIT4466001:C87414 UTSW 5 93636288 missense probably damaging 1.00
R1830:C87414 UTSW 5 93637686 missense probably benign 0.03
R2071:C87414 UTSW 5 93636516 missense probably damaging 1.00
R4404:C87414 UTSW 5 93637713 missense possibly damaging 0.81
R4606:C87414 UTSW 5 93636602 missense probably damaging 0.96
R4672:C87414 UTSW 5 93636323 missense probably damaging 0.99
R5056:C87414 UTSW 5 93638925 start gained probably benign
R5118:C87414 UTSW 5 93637797 missense probably benign 0.03
R5288:C87414 UTSW 5 93637748 missense possibly damaging 0.86
R5441:C87414 UTSW 5 93636597 missense possibly damaging 0.84
R6190:C87414 UTSW 5 93638078 missense probably benign 0.14
R6513:C87414 UTSW 5 93637532 splice site probably null
R7464:C87414 UTSW 5 93636240 missense probably damaging 1.00
R7961:C87414 UTSW 5 93636684 missense probably damaging 1.00
R8130:C87414 UTSW 5 93636738 missense probably damaging 1.00
R8389:C87414 UTSW 5 93637728 missense probably benign 0.10
RF006:C87414 UTSW 5 93636703 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATAACTTGGTCTGGTGGGTCCC -3'
(R):5'- CCACCTTGGATATCAGGTGC -3'

Sequencing Primer
(F):5'- GTGGGTCCCAGATCCTCATC -3'
(R):5'- CCTTGGATATCAGGTGCTTAAAAAG -3'
Posted On2020-09-15