Incidental Mutation 'R7941:Psg20'
ID649051
Institutional Source Beutler Lab
Gene Symbol Psg20
Ensembl Gene ENSMUSG00000063305
Gene Namepregnancy-specific glycoprotein 20
Synonymscea7, EG434540
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18674107-18686185 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 18681177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076677] [ENSMUST00000076677] [ENSMUST00000076677] [ENSMUST00000108482] [ENSMUST00000108482] [ENSMUST00000108482]
Predicted Effect probably null
Transcript: ENSMUST00000076677
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076677
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076677
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108482
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108482
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108482
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Psg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Psg20 APN 7 18674611 missense possibly damaging 0.72
IGL01459:Psg20 APN 7 18682713 missense probably damaging 1.00
IGL01599:Psg20 APN 7 18681038 missense possibly damaging 0.83
IGL01678:Psg20 APN 7 18680870 missense probably damaging 1.00
IGL01991:Psg20 APN 7 18684425 missense probably benign 0.01
IGL02449:Psg20 APN 7 18684408 splice site probably benign
IGL02522:Psg20 APN 7 18682431 missense probably benign 0.06
IGL03358:Psg20 APN 7 18680966 missense probably benign 0.04
PIT4431001:Psg20 UTSW 7 18674550 missense probably damaging 1.00
R0136:Psg20 UTSW 7 18682507 missense probably damaging 0.98
R0184:Psg20 UTSW 7 18685976 missense probably null 0.95
R0894:Psg20 UTSW 7 18681044 nonsense probably null
R1291:Psg20 UTSW 7 18684674 missense possibly damaging 0.46
R1997:Psg20 UTSW 7 18682610 missense probably benign 0.00
R2118:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2119:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2120:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2121:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2124:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2127:Psg20 UTSW 7 18682718 missense probably damaging 0.99
R3795:Psg20 UTSW 7 18684449 missense probably benign 0.09
R4115:Psg20 UTSW 7 18685980 missense probably damaging 1.00
R4238:Psg20 UTSW 7 18684509 missense probably damaging 1.00
R5004:Psg20 UTSW 7 18680912 missense probably damaging 1.00
R5025:Psg20 UTSW 7 18674366 makesense probably null
R6294:Psg20 UTSW 7 18682679 missense probably damaging 1.00
R6733:Psg20 UTSW 7 18674622 missense probably damaging 0.99
R6744:Psg20 UTSW 7 18674580 missense probably damaging 1.00
R6799:Psg20 UTSW 7 18684420 missense probably benign 0.06
R7466:Psg20 UTSW 7 18684467 missense probably benign 0.00
R7524:Psg20 UTSW 7 18684659 missense probably benign 0.18
R7583:Psg20 UTSW 7 18682483 missense probably damaging 1.00
R8010:Psg20 UTSW 7 18681067 missense probably benign 0.06
R8247:Psg20 UTSW 7 18682637 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGGATCCATTAGTGTACCC -3'
(R):5'- ATGACAGATTCTGTGGCACTG -3'

Sequencing Primer
(F):5'- GTAGCCACTGAAAATGGACTTCATCG -3'
(R):5'- CACTGAGGGCTGTTGCTGAC -3'
Posted On2020-09-15