Incidental Mutation 'R7941:Lsr'
ID649052
Institutional Source Beutler Lab
Gene Symbol Lsr
Ensembl Gene ENSMUSG00000001247
Gene Namelipolysis stimulated lipoprotein receptor
SynonymsLisch7, ILDR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30957770-30973464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30973095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 27 (I27L)
Ref Sequence ENSEMBL: ENSMUSP00000001279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
AA Change: I27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247
AA Change: I27L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058093
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
AA Change: I27L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247
AA Change: I27L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
AA Change: I27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247
AA Change: I27L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
AA Change: I27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247
AA Change: I27L

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
AA Change: I27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during fetal growth and development, liver hypoplasia, and variable penetrance of pallor, hemorrhaging, superficial skin detachment, and reduced size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Lsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Lsr APN 7 30971996 missense probably damaging 1.00
IGL01893:Lsr APN 7 30962232 missense possibly damaging 0.90
IGL02557:Lsr APN 7 30958494 missense possibly damaging 0.90
IGL02800:Lsr APN 7 30958413 missense probably damaging 1.00
IGL03030:Lsr APN 7 30959281 missense possibly damaging 0.50
IGL03166:Lsr APN 7 30962097 critical splice donor site probably null
R0349:Lsr UTSW 7 30959273 missense probably damaging 1.00
R0513:Lsr UTSW 7 30958338 missense probably benign 0.01
R1226:Lsr UTSW 7 30971883 missense probably damaging 1.00
R1539:Lsr UTSW 7 30972092 missense possibly damaging 0.78
R2281:Lsr UTSW 7 30958345 missense probably damaging 1.00
R4208:Lsr UTSW 7 30973094 missense probably benign 0.00
R4422:Lsr UTSW 7 30965997 missense probably benign 0.08
R4544:Lsr UTSW 7 30971976 missense probably damaging 1.00
R4727:Lsr UTSW 7 30966040 missense probably damaging 1.00
R4791:Lsr UTSW 7 30958552 missense probably damaging 0.99
R4946:Lsr UTSW 7 30958209 missense probably benign 0.17
R5157:Lsr UTSW 7 30966040 missense probably damaging 1.00
R5652:Lsr UTSW 7 30959031 missense probably damaging 1.00
R6052:Lsr UTSW 7 30958617 missense probably damaging 1.00
R6314:Lsr UTSW 7 30958599 missense probably damaging 1.00
R6566:Lsr UTSW 7 30972083 missense possibly damaging 0.92
R6917:Lsr UTSW 7 30958296 missense possibly damaging 0.94
R7842:Lsr UTSW 7 30966012 missense possibly damaging 0.82
X0050:Lsr UTSW 7 30972177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAACTCCCTTCCTTGGGC -3'
(R):5'- ATGGACTTGGAATAGGGGCC -3'

Sequencing Primer
(F):5'- ACAGGGGTCTCCTCAACCAG -3'
(R):5'- GGAATAGGGGCCGGGCG -3'
Posted On2020-09-15