Incidental Mutation 'R7941:Svip'
ID649053
Institutional Source Beutler Lab
Gene Symbol Svip
Ensembl Gene ENSMUSG00000074093
Gene Namesmall VCP/p97-interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location51997171-52006018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52003413 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 51 (K51R)
Ref Sequence ENSEMBL: ENSMUSP00000096014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098414] [ENSMUST00000209193]
Predicted Effect probably benign
Transcript: ENSMUST00000098414
AA Change: K51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096014
Gene: ENSMUSG00000074093
AA Change: K51R

DomainStartEndE-ValueType
Pfam:SVIP 1 73 1.5e-27 PFAM
Predicted Effect silent
Transcript: ENSMUST00000209193
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endoplasmic reticulum-associated degradation (ERAD) is the pathway by which misfolded proteins in the endoplasmic reticulum are targeted to the proteasome for degradation. Multiple specialized proteins interact with one another during ERAD to complete this process. The protein encoded by this gene is an inhibitor of ERAD, functioning to disrupt the interaction of these protein components. This downregulation of ERAD may be needed to protect the cell from overactive protein degradation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Svip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02886:Svip APN 7 52005761 missense possibly damaging 0.86
R6127:Svip UTSW 7 52003453 missense probably benign
R7181:Svip UTSW 7 52003429 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TAAGTAGACACTTCCTCTAGCCTATG -3'
(R):5'- GAATTCCCTGTGGTTTTCCCAG -3'

Sequencing Primer
(F):5'- CCTATGTTCTTGATTGATTTTCAAGC -3'
(R):5'- TTTCCCAGATGAAACGGCTG -3'
Posted On2020-09-15