Mutagenetix > Incidental Mutations

Incidental Mutation 'R7941:Il16'

649054

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R7941 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83682829 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 181 (D181V)

Ref Sequence

ENSEMBL: ENSMUSP00000001792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001792
AA Change: D181V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: D181V

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000153560
AA Change: D181V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741
AA Change: D181V

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC

Meta Mutation Damage Score

0.1575

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl1	T	C	2: 31,689,679		probably benign	Het
AI467606	A	G	7: 127,092,421	E56G	probably damaging	Het
Ak9	C	T	10: 41,409,137	P1403S	unknown	Het
Akr1c14	A	G	13: 4,059,713	K28E	probably benign	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Anks1b	A	T	10: 90,577,155	N55I	probably damaging	Het
C87414	A	T	5: 93,638,028	V131D	probably benign	Het
Cabyr	T	C	18: 12,744,768	L54P	probably damaging	Het
Cachd1	A	T	4: 100,988,173	N954I	probably damaging	Het
Cenpf	A	G	1: 189,657,286	S1450P	probably damaging	Het
Chst10	T	A	1: 38,871,691	I131L	probably damaging	Het
Cluh	A	T	11: 74,659,757	M270L	probably benign	Het
Dagla	T	C	19: 10,271,503	H29R	probably damaging	Het
Dusp5	A	G	19: 53,537,533	N202S	probably benign	Het
Elavl3	A	G	9: 22,036,316	I110T	possibly damaging	Het
Fam222b	G	T	11: 78,155,059	G482V	possibly damaging	Het
Fbxl7	A	G	15: 26,543,613	L316P	probably damaging	Het
Gad1	T	A	2: 70,594,585		probably null	Het
H2-K1	T	C	17: 33,999,331	T204A	probably benign	Het
Hmcn1	A	G	1: 150,650,084	V3296A	possibly damaging	Het
Hyal1	T	C	9: 107,578,100	F203S	probably damaging	Het
Ip6k1	T	C	9: 108,024,432	F69L	probably damaging	Het
Klf4	G	A	4: 55,531,755		probably benign	Het
Lsr	T	G	7: 30,973,095	I27L	probably benign	Het
Mettl4	A	T	17: 94,733,194		probably null	Het
Mpdz	A	G	4: 81,282,750	V1902A	probably benign	Het
Nfkbiz	C	T	16: 55,821,944	G37D	probably damaging	Het
Olfr1131	T	C	2: 87,628,904	V31A	probably benign	Het
Otogl	A	T	10: 107,806,802		probably null	Het
Pcdh1	T	C	18: 38,199,080	D429G	probably damaging	Het
Prelid2	A	T	18: 41,932,751	L73*	probably null	Het
Psg20	T	A	7: 18,681,177		probably null	Het
Ptprb	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,677		probably benign	Het
Rab24	C	T	13: 55,320,307		probably null	Het
Rag1	T	G	2: 101,642,346	K817T	probably benign	Het
Rgl2	T	C	17: 33,931,739	V57A	probably benign	Het
Ric1	T	C	19: 29,533,259	M80T	probably damaging	Het
Sh3rf3	T	C	10: 59,007,061	I283T	probably damaging	Het
Skint2	C	A	4: 112,625,990	N197K	probably damaging	Het
Snapc4	A	G	2: 26,376,718	I126T	probably damaging	Het
Srcap	GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	7: 127,558,290		probably benign	Het
Svip	T	C	7: 52,003,413	K51R	probably benign	Het
Syndig1	T	A	2: 149,899,788	V98E	probably benign	Het
Tshz1	A	T	18: 84,015,392	M297K	possibly damaging	Het
Ttn	A	G	2: 76,919,350	V3785A	probably benign	Het
Usf3	T	C	16: 44,215,561	S135P	probably damaging	Het
Vmn2r10	A	T	5: 108,996,440	M548K	probably damaging	Het
Vmn2r92	T	C	17: 18,184,837	S748P	possibly damaging	Het
Zbtb39	A	G	10: 127,743,540	Y661C	probably damaging	Het
Zfp804b	A	G	5: 6,770,042	I1007T	probably benign	Het
Zscan4-ps2	A	G	7: 11,517,672	I212V	probably benign	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AACAGGTGGGCCTTGCTAAAC -3'
(R):5'- CCTAAGGGAGGGCTGGTAATTG -3'

Sequencing Primer
(F):5'- GCCTTGCTAAACGACAGATGCTTG -3'
(R):5'- TTGGTGTTTGAGTGCACACAAATTTC -3'

Posted On

2020-09-15