Incidental Mutation 'R7941:Elavl3'
ID 649057
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene Name ELAV like RNA binding protein 3
Synonyms 2600009P04Rik, Huc, mHuC
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock # R7941 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22015005-22052023 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22036316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 110 (I110T)
Ref Sequence ENSEMBL: ENSMUSP00000003501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003501] [ENSMUST00000215901]
AlphaFold Q60900
PDB Structure SOLUTION STRUCTURE OF THE FIRST RNA-BINDING DOMAIN (RBD1) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SECOND RNA-BINDING DOMAIN (RBD2) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE HUC RBD1-RBD2 COMPLEXED WITH THE AU-RICH ELEMENT [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003501
AA Change: I110T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410
AA Change: I110T

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect possibly damaging
Transcript: ENSMUST00000215901
AA Change: I109T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.7472 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0022:Elavl3 UTSW 9 22036871 splice site probably benign
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R0850:Elavl3 UTSW 9 22036763 missense probably damaging 0.96
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3714:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3715:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R6593:Elavl3 UTSW 9 22018547 missense possibly damaging 0.58
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
R7897:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
R8710:Elavl3 UTSW 9 22026553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTGGCAGATTCTCTATG -3'
(R):5'- ACAAGTGTGACCTTGGTGGG -3'

Sequencing Primer
(F):5'- TGATAGTGCATTCTCCAGCCAGG -3'
(R):5'- AAGTGGCTCTCTGGGGAACAC -3'
Posted On 2020-09-15