Incidental Mutation 'R7941:Ip6k1'
ID649059
Institutional Source Beutler Lab
Gene Symbol Ip6k1
Ensembl Gene ENSMUSG00000032594
Gene Nameinositol hexaphosphate kinase 1
Synonyms1200016D08Rik, InsP6, Ihpk1, InsP6k1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108002501-108048782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108024432 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 69 (F69L)
Ref Sequence ENSEMBL: ENSMUSP00000035214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176356] [ENSMUST00000176566] [ENSMUST00000176854]
Predicted Effect probably damaging
Transcript: ENSMUST00000035214
AA Change: F69L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: F69L

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164395
AA Change: F69L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000175874
AA Change: F69L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594
AA Change: F69L

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect possibly damaging
Transcript: ENSMUST00000176854
AA Change: F69L

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141232
Gene: ENSMUSG00000032594
AA Change: F69L

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Ip6k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Ip6k1 APN 9 108045883 missense probably benign 0.01
R0147:Ip6k1 UTSW 9 108045894 missense probably damaging 1.00
R1371:Ip6k1 UTSW 9 108045823 missense probably damaging 0.96
R1530:Ip6k1 UTSW 9 108045562 nonsense probably null
R1716:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1717:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1718:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1719:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1741:Ip6k1 UTSW 9 108040984 missense probably benign 0.43
R1745:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1747:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1901:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1902:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1903:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1962:Ip6k1 UTSW 9 108041088 critical splice donor site probably null
R2126:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R3809:Ip6k1 UTSW 9 108045887 missense probably damaging 1.00
R5000:Ip6k1 UTSW 9 108045599 nonsense probably null
R6074:Ip6k1 UTSW 9 108024109 utr 5 prime probably benign
R6921:Ip6k1 UTSW 9 108024435 missense probably damaging 1.00
R7069:Ip6k1 UTSW 9 108045452 splice site probably null
R7154:Ip6k1 UTSW 9 108045662 missense probably damaging 1.00
R7218:Ip6k1 UTSW 9 108045582 missense unknown
R7330:Ip6k1 UTSW 9 108045253 missense possibly damaging 0.56
R7731:Ip6k1 UTSW 9 108044728 missense probably damaging 1.00
R7736:Ip6k1 UTSW 9 108045692 missense probably damaging 1.00
R7765:Ip6k1 UTSW 9 108032089 missense possibly damaging 0.52
R8221:Ip6k1 UTSW 9 108045916 missense probably benign 0.40
R8383:Ip6k1 UTSW 9 108044727 missense possibly damaging 0.81
X0021:Ip6k1 UTSW 9 108032190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAACCATGGAAGTGGGGC -3'
(R):5'- CAATAGGCTTTTCTCCACCAATG -3'

Sequencing Primer
(F):5'- CCATGGAAGTGGGGCAGTATG -3'
(R):5'- TGGGTCTACCTAATGTCAATTTTTC -3'
Posted On2020-09-15