Incidental Mutation 'R7941:Sh3rf3'
ID649061
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene NameSH3 domain containing ring finger 3
SynonymsSh3md4, 4831416G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58813359-59138916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59007061 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 283 (I283T)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135526] [ENSMUST00000153031]
Predicted Effect probably damaging
Transcript: ENSMUST00000135526
AA Change: I283T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114368
Gene: ENSMUSG00000037990
AA Change: I283T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153031
AA Change: I283T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: I283T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 59049356 missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 59049530 missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 59135828 missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 59086740 missense probably benign 0.02
exasperated UTSW 10 59086824 missense probably benign 0.06
strained UTSW 10 59007103 missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58984075 missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 59007082 missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 59131077 missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 59086667 nonsense probably null
R1869:Sh3rf3 UTSW 10 59083513 missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 59104167 splice site probably benign
R1968:Sh3rf3 UTSW 10 58813987 missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 59007073 missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 59086863 missense possibly damaging 0.83
R3769:Sh3rf3 UTSW 10 58984191 missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 59083533 missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 59083576 missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58813704 missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58814083 missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 59083519 missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58813723 missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 59086824 missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 59131190 missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58813947 missense probably benign
R5716:Sh3rf3 UTSW 10 59131283 missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 59104382 missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58984153 missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 59049448 missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 59130986 missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 59007076 missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58984144 missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58983969 missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 59083467 missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 59086841 missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 59071973 missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 59086815 missense probably benign 0.01
R7959:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R8140:Sh3rf3 UTSW 10 59049355 missense possibly damaging 0.88
R8142:Sh3rf3 UTSW 10 59049383 nonsense probably null
R8241:Sh3rf3 UTSW 10 59104420 missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 59083585 missense probably damaging 1.00
RF020:Sh3rf3 UTSW 10 58813768 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGTTATGATAAGATGGAGGGAC -3'
(R):5'- AAGCAGGAGGCCTTACACAG -3'

Sequencing Primer
(F):5'- TTATGATAAGATGGAGGGACACGGAG -3'
(R):5'- CCTTACACAGTGGGGAAGAAGCTC -3'
Posted On2020-09-15