Incidental Mutation 'R7941:Anks1b'
ID649062
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90577155 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 55 (N55I)
Ref Sequence ENSEMBL: ENSMUSP00000138679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099364] [ENSMUST00000099368] [ENSMUST00000182045] [ENSMUST00000182053] [ENSMUST00000182083] [ENSMUST00000182113] [ENSMUST00000182284] [ENSMUST00000182356] [ENSMUST00000182427] [ENSMUST00000182430] [ENSMUST00000182550] [ENSMUST00000182595] [ENSMUST00000182600] [ENSMUST00000182786] [ENSMUST00000182907] [ENSMUST00000182960] [ENSMUST00000183136] [ENSMUST00000183156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099364
AA Change: N55I

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096965
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 131 269 1.5e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099368
AA Change: N828I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: N828I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182045
AA Change: N55I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138679
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
Pfam:SAM_1 34 69 1.6e-9 PFAM
Pfam:SAM_2 34 75 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182053
AA Change: N24I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138644
Gene: ENSMUSG00000058589
AA Change: N24I

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
PTB 192 330 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182083
Predicted Effect possibly damaging
Transcript: ENSMUST00000182113
AA Change: N55I

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138655
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182284
AA Change: N55I

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138794
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 248 386 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182356
SMART Domains Protein: ENSMUSP00000138234
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
low complexity region 138 153 N/A INTRINSIC
PTB 226 364 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182427
AA Change: N24I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138480
Gene: ENSMUSG00000058589
AA Change: N24I

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
low complexity region 164 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182430
AA Change: N55I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138660
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 223 361 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182550
AA Change: N55I

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138643
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 308 446 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182595
AA Change: N55I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138314
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 283 421 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182600
SMART Domains Protein: ENSMUSP00000138650
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
PTB 216 354 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182786
SMART Domains Protein: ENSMUSP00000138720
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
Pfam:SAM_2 1 42 8.4e-8 PFAM
Pfam:SAM_1 2 43 5.4e-7 PFAM
Pfam:SAM_1 51 97 4.4e-10 PFAM
Pfam:SAM_2 52 95 6.1e-7 PFAM
PTB 155 293 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182960
AA Change: N55I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138222
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 247 385 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183136
AA Change: N55I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138738
Gene: ENSMUSG00000058589
AA Change: N55I

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: N828I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: N828I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.2139 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
R7578:Anks1b UTSW 10 90049927 missense probably damaging 1.00
R7604:Anks1b UTSW 10 90260846 splice site probably null
R7633:Anks1b UTSW 10 90948584 missense probably damaging 1.00
R7881:Anks1b UTSW 10 90967018 missense probably benign 0.07
R7910:Anks1b UTSW 10 90680792 missense probably damaging 1.00
R8045:Anks1b UTSW 10 90680860 missense probably benign
R8146:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R8176:Anks1b UTSW 10 90069491 missense probably damaging 1.00
RF004:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF008:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF017:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF018:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF023:Anks1b UTSW 10 90033225 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGGCTCCTTTGATAACAAC -3'
(R):5'- ACACAACAAGTTCTGTCCTAAAGG -3'

Sequencing Primer
(F):5'- AACTTCCCCAGGAGCATGATGTG -3'
(R):5'- AAGTTCTGTCCTAAAGGCATCCCG -3'
Posted On2020-09-15