Incidental Mutation 'R7941:Zbtb39'
ID649064
Institutional Source Beutler Lab
Gene Symbol Zbtb39
Ensembl Gene ENSMUSG00000044617
Gene Namezinc finger and BTB domain containing 39
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127739538-127747349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127743540 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 661 (Y661C)
Ref Sequence ENSEMBL: ENSMUSP00000052717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably damaging
Transcript: ENSMUST00000054287
AA Change: Y661C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617
AA Change: Y661C

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079692
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Zbtb39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zbtb39 APN 10 127742366 missense probably benign 0.00
R0636:Zbtb39 UTSW 10 127742835 missense probably benign 0.01
R0959:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0959:Zbtb39 UTSW 10 127743062 missense probably damaging 1.00
R0962:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0964:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1188:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1189:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1239:Zbtb39 UTSW 10 127743069 missense probably damaging 1.00
R1341:Zbtb39 UTSW 10 127743500 missense possibly damaging 0.91
R1838:Zbtb39 UTSW 10 127742700 missense probably damaging 1.00
R2012:Zbtb39 UTSW 10 127742834 missense probably benign 0.43
R2167:Zbtb39 UTSW 10 127742975 missense probably benign 0.03
R2346:Zbtb39 UTSW 10 127741581 missense possibly damaging 0.49
R4041:Zbtb39 UTSW 10 127743554 missense probably damaging 1.00
R4171:Zbtb39 UTSW 10 127742367 missense possibly damaging 0.51
R4409:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4410:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4539:Zbtb39 UTSW 10 127742192 missense possibly damaging 0.90
R5761:Zbtb39 UTSW 10 127742646 missense probably damaging 1.00
R5766:Zbtb39 UTSW 10 127742688 missense probably damaging 1.00
R5812:Zbtb39 UTSW 10 127741560 start codon destroyed probably null 0.99
R6710:Zbtb39 UTSW 10 127743636 missense probably damaging 1.00
R6919:Zbtb39 UTSW 10 127741842 missense probably damaging 1.00
X0024:Zbtb39 UTSW 10 127741766 missense probably damaging 1.00
Z1177:Zbtb39 UTSW 10 127742427 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCCTGGGAATAGTAAGTACAGTTG -3'
(R):5'- TACAAAGTCACTATCCCGGC -3'

Sequencing Primer
(F):5'- TACAGTTGTAAGGTCTGTGGCAAAAG -3'
(R):5'- GGAGCTCCCTCTGACTCTG -3'
Posted On2020-09-15