Incidental Mutation 'R7941:Cluh'
ID649065
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74659757 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 270 (M270L)
Ref Sequence ENSEMBL: ENSMUSP00000090593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
Predicted Effect probably benign
Transcript: ENSMUST00000092915
AA Change: M270L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: M270L

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117818
AA Change: M270L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: M270L

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACCTGAGTATATCCTGCCGG -3'
(R):5'- TCACAAAGCAGGTGCCGTAAG -3'

Sequencing Primer
(F):5'- AGTATATCCTGCCGGGGAGC -3'
(R):5'- AAAGCAGGTGCCGTAAGTATTTGTC -3'
Posted On2020-09-15