Incidental Mutation 'R7941:Fam222b'
ID649066
Institutional Source Beutler Lab
Gene Symbol Fam222b
Ensembl Gene ENSMUSG00000037750
Gene Namefamily with sequence similarity 222, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78094660-78156700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78155059 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 482 (G482V)
Ref Sequence ENSEMBL: ENSMUSP00000073384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000073705] [ENSMUST00000100782] [ENSMUST00000155571]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073705
AA Change: G482V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750
AA Change: G482V

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100782
AA Change: G354V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126620
Gene: ENSMUSG00000037750
AA Change: G354V

DomainStartEndE-ValueType
Pfam:FAM222A 1 434 1.9e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155571
AA Change: G482V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750
AA Change: G482V

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Fam222b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Fam222b APN 11 78154488 missense probably damaging 0.96
IGL01948:Fam222b APN 11 78154339 missense probably damaging 1.00
IGL02967:Fam222b APN 11 78154108 missense probably benign 0.44
H8562:Fam222b UTSW 11 78154578 missense probably damaging 0.99
R0087:Fam222b UTSW 11 78153892 missense probably benign 0.23
R0385:Fam222b UTSW 11 78154930 missense probably benign 0.01
R0478:Fam222b UTSW 11 78153856 missense probably damaging 1.00
R1565:Fam222b UTSW 11 78154662 missense possibly damaging 0.82
R1586:Fam222b UTSW 11 78154521 missense probably damaging 1.00
R1661:Fam222b UTSW 11 78155161 missense probably damaging 1.00
R1829:Fam222b UTSW 11 78155035 missense probably damaging 0.96
R1878:Fam222b UTSW 11 78143216 critical splice donor site probably null
R2301:Fam222b UTSW 11 78154543 missense probably damaging 1.00
R3120:Fam222b UTSW 11 78153916 missense probably damaging 1.00
R3915:Fam222b UTSW 11 78154930 missense probably benign 0.26
R4003:Fam222b UTSW 11 78154929 missense probably benign 0.13
R4748:Fam222b UTSW 11 78154603 missense possibly damaging 0.59
R4982:Fam222b UTSW 11 78154743 missense probably damaging 0.98
R5307:Fam222b UTSW 11 78153768 missense probably damaging 1.00
R5590:Fam222b UTSW 11 78155032 missense probably benign 0.16
R5618:Fam222b UTSW 11 78154240 missense probably benign 0.05
R7181:Fam222b UTSW 11 78154978 missense probably damaging 1.00
R7199:Fam222b UTSW 11 78154857 missense possibly damaging 0.55
R7285:Fam222b UTSW 11 78143181 missense probably benign 0.04
R7467:Fam222b UTSW 11 78154347 missense probably damaging 1.00
R7726:Fam222b UTSW 11 78153751 missense probably damaging 1.00
R7804:Fam222b UTSW 11 78154153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACAGTCCTTCCATCTG -3'
(R):5'- TTCGACTATCTGTGGGATCAGG -3'

Sequencing Primer
(F):5'- ATCTGAAGCCACCCCTGGAG -3'
(R):5'- CTATCTGTGGGATCAGGGGCTC -3'
Posted On2020-09-15