Incidental Mutation 'R7941:Akr1c14'
ID649067
Institutional Source Beutler Lab
Gene Symbol Akr1c14
Ensembl Gene ENSMUSG00000033715
Gene Namealdo-keto reductase family 1, member C14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location4049011-4090688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4059713 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 28 (K28E)
Ref Sequence ENSEMBL: ENSMUSP00000045394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041768] [ENSMUST00000118717]
Predicted Effect probably benign
Transcript: ENSMUST00000041768
AA Change: K28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045394
Gene: ENSMUSG00000033715
AA Change: K28E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118717
AA Change: K28E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112664
Gene: ENSMUSG00000033715
AA Change: K28E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 8.1e-51 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Akr1c14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Akr1c14 APN 13 4081139 missense probably damaging 1.00
IGL02085:Akr1c14 APN 13 4078035 nonsense probably null
IGL02201:Akr1c14 APN 13 4081022 missense probably damaging 1.00
IGL02419:Akr1c14 APN 13 4080617 critical splice acceptor site probably null
IGL03293:Akr1c14 APN 13 4079130 nonsense probably null
PIT4362001:Akr1c14 UTSW 13 4079100 missense probably damaging 1.00
R0518:Akr1c14 UTSW 13 4081016 missense probably damaging 1.00
R2168:Akr1c14 UTSW 13 4081106 missense probably damaging 1.00
R4751:Akr1c14 UTSW 13 4065338 missense possibly damaging 0.61
R4812:Akr1c14 UTSW 13 4079165 missense probably damaging 1.00
R5030:Akr1c14 UTSW 13 4079102 missense probably damaging 1.00
R6329:Akr1c14 UTSW 13 4087302 missense probably damaging 1.00
R6590:Akr1c14 UTSW 13 4063713 missense possibly damaging 0.90
R6612:Akr1c14 UTSW 13 4065331 missense probably benign 0.00
R6690:Akr1c14 UTSW 13 4063713 missense possibly damaging 0.90
R7033:Akr1c14 UTSW 13 4079178 critical splice donor site probably null
R7200:Akr1c14 UTSW 13 4081051 missense probably benign 0.00
R7257:Akr1c14 UTSW 13 4088966 missense probably benign 0.03
R7432:Akr1c14 UTSW 13 4088952 missense probably benign
R7536:Akr1c14 UTSW 13 4063690 missense probably damaging 1.00
R7769:Akr1c14 UTSW 13 4059644 missense probably benign 0.00
R8292:Akr1c14 UTSW 13 4080995 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGACTATTGCTTTAAGCTGGCTC -3'
(R):5'- TCCACATGATAAGTCTCCAAGG -3'

Sequencing Primer
(F):5'- GCCATTGTTTAACTTTCCAGGAG -3'
(R):5'- GTCTCCAAGGAACAGTAACAAGTCTG -3'
Posted On2020-09-15