Mutagenetix > Incidental Mutations

Incidental Mutation 'R7941:Fbxl7'

649068

Institutional Source

Beutler Lab

Gene Symbol

Fbxl7

Ensembl Gene

ENSMUSG00000043556

Gene Name

F-box and leucine-rich repeat protein 7

Synonyms

D230018M15Rik, Fbl6, FBL7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7941 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26540459-26895580 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26543613 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 316 (L316P)

Ref Sequence

ENSEMBL: ENSMUSP00000061305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059204]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059204
AA Change: L316P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: L316P

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
low complexity region	73	79	N/A	INTRINSIC
FBOX	117	157	2.7e-11	SMART
LRR_CC	185	210	2e-7	SMART
LRR_CC	211	236	2.1e-7	SMART
LRR	237	262	6.3e-7	SMART
LRR	271	296	3.5e-1	SMART
LRR_CC	297	322	1.7e-8	SMART
LRR_CC	323	348	5.5e-8	SMART
LRR_CC	349	374	6.5e-8	SMART
LRR_CC	375	400	9.1e-10	SMART
LRR_CC	401	426	2.1e-8	SMART
LRR_CC	427	452	1.8e-7	SMART
Blast:LRR	453	477	2e-7	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl1	T	C	2: 31,689,679		probably benign	Het
AI467606	A	G	7: 127,092,421	E56G	probably damaging	Het
Ak9	C	T	10: 41,409,137	P1403S	unknown	Het
Akr1c14	A	G	13: 4,059,713	K28E	probably benign	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Anks1b	A	T	10: 90,577,155	N55I	probably damaging	Het
C87414	A	T	5: 93,638,028	V131D	probably benign	Het
Cabyr	T	C	18: 12,744,768	L54P	probably damaging	Het
Cachd1	A	T	4: 100,988,173	N954I	probably damaging	Het
Cenpf	A	G	1: 189,657,286	S1450P	probably damaging	Het
Chst10	T	A	1: 38,871,691	I131L	probably damaging	Het
Cluh	A	T	11: 74,659,757	M270L	probably benign	Het
Dagla	T	C	19: 10,271,503	H29R	probably damaging	Het
Dusp5	A	G	19: 53,537,533	N202S	probably benign	Het
Elavl3	A	G	9: 22,036,316	I110T	possibly damaging	Het
Fam222b	G	T	11: 78,155,059	G482V	possibly damaging	Het
Gad1	T	A	2: 70,594,585		probably null	Het
H2-K1	T	C	17: 33,999,331	T204A	probably benign	Het
Hmcn1	A	G	1: 150,650,084	V3296A	possibly damaging	Het
Hyal1	T	C	9: 107,578,100	F203S	probably damaging	Het
Il16	T	A	7: 83,682,829	D181V	probably damaging	Het
Ip6k1	T	C	9: 108,024,432	F69L	probably damaging	Het
Klf4	G	A	4: 55,531,755		probably benign	Het
Lsr	T	G	7: 30,973,095	I27L	probably benign	Het
Mettl4	A	T	17: 94,733,194		probably null	Het
Mpdz	A	G	4: 81,282,750	V1902A	probably benign	Het
Nfkbiz	C	T	16: 55,821,944	G37D	probably damaging	Het
Olfr1131	T	C	2: 87,628,904	V31A	probably benign	Het
Otogl	A	T	10: 107,806,802		probably null	Het
Pcdh1	T	C	18: 38,199,080	D429G	probably damaging	Het
Prelid2	A	T	18: 41,932,751	L73*	probably null	Het
Psg20	T	A	7: 18,681,177		probably null	Het
Ptprb	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,677		probably benign	Het
Rab24	C	T	13: 55,320,307		probably null	Het
Rag1	T	G	2: 101,642,346	K817T	probably benign	Het
Rgl2	T	C	17: 33,931,739	V57A	probably benign	Het
Ric1	T	C	19: 29,533,259	M80T	probably damaging	Het
Sh3rf3	T	C	10: 59,007,061	I283T	probably damaging	Het
Skint2	C	A	4: 112,625,990	N197K	probably damaging	Het
Snapc4	A	G	2: 26,376,718	I126T	probably damaging	Het
Srcap	GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT	7: 127,558,290		probably benign	Het
Svip	T	C	7: 52,003,413	K51R	probably benign	Het
Syndig1	T	A	2: 149,899,788	V98E	probably benign	Het
Tshz1	A	T	18: 84,015,392	M297K	possibly damaging	Het
Ttn	A	G	2: 76,919,350	V3785A	probably benign	Het
Usf3	T	C	16: 44,215,561	S135P	probably damaging	Het
Vmn2r10	A	T	5: 108,996,440	M548K	probably damaging	Het
Vmn2r92	T	C	17: 18,184,837	S748P	possibly damaging	Het
Zbtb39	A	G	10: 127,743,540	Y661C	probably damaging	Het
Zfp804b	A	G	5: 6,770,042	I1007T	probably benign	Het
Zscan4-ps2	A	G	7: 11,517,672	I212V	probably benign	Het

Other mutations in Fbxl7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01979:Fbxl7	APN	15	26789563	missense	probably damaging	0.98
R0482:Fbxl7	UTSW	15	26543546	missense	probably benign	0.06
R1734:Fbxl7	UTSW	15	26543649	missense	probably damaging	1.00
R1826:Fbxl7	UTSW	15	26552765	missense	possibly damaging	0.59
R1859:Fbxl7	UTSW	15	26543193	missense	probably damaging	1.00
R2410:Fbxl7	UTSW	15	26895025	missense	possibly damaging	0.79
R3703:Fbxl7	UTSW	15	26543755	missense	probably damaging	1.00
R3704:Fbxl7	UTSW	15	26543755	missense	probably damaging	1.00
R4025:Fbxl7	UTSW	15	26552819	missense	probably benign	0.20
R4387:Fbxl7	UTSW	15	26543259	missense	probably damaging	1.00
R5055:Fbxl7	UTSW	15	26552936	missense	probably damaging	0.98
R5070:Fbxl7	UTSW	15	26789554	missense	probably benign	0.15
R5180:Fbxl7	UTSW	15	26543421	missense	probably damaging	1.00
R5260:Fbxl7	UTSW	15	26543499	missense	probably damaging	1.00
R5720:Fbxl7	UTSW	15	26552893	missense	probably damaging	0.98
R6256:Fbxl7	UTSW	15	26553002	missense	probably benign	0.16
R6874:Fbxl7	UTSW	15	26552942	missense	probably benign
R7143:Fbxl7	UTSW	15	26543158	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGCATTGAGGTAGCGTAATTTGC -3'
(R):5'- AGTGACCTGCATCAGCTTGAC -3'

Sequencing Primer
(F):5'- GCTGCAGTATTTAGCCACATAACG -3'
(R):5'- ATCAGCTTGACCCGGGAG -3'

Posted On

2020-09-15