Incidental Mutation 'R7941:H2-K1'
ID649073
Institutional Source Beutler Lab
Gene Symbol H2-K1
Ensembl Gene ENSMUSG00000061232
Gene Namehistocompatibility 2, K1, K region
SynonymsH-2K
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7941 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33996017-34000333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33999331 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000133847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025181] [ENSMUST00000087189] [ENSMUST00000172912] [ENSMUST00000173075]
Predicted Effect probably benign
Transcript: ENSMUST00000025181
AA Change: T184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025181
Gene: ENSMUSG00000061232
AA Change: T184A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.4e-95 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 335 359 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087189
SMART Domains Protein: ENSMUSP00000084436
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
IGc1 37 108 9.98e-22 SMART
low complexity region 124 143 N/A INTRINSIC
Pfam:MHC_I_C 152 177 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172782
Predicted Effect probably benign
Transcript: ENSMUST00000172912
AA Change: T184A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134004
Gene: ENSMUSG00000061232
AA Change: T184A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.7e-97 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 334 359 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173075
AA Change: T204A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133847
Gene: ENSMUSG00000061232
AA Change: T204A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 42 220 3.7e-97 PFAM
Pfam:C1-set 229 289 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173602
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display T-cell abnormalities and abnormal susceptibility to various viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in H2-K1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:H2-K1 APN 17 33999492 missense probably damaging 1.00
FR4548:H2-K1 UTSW 17 33997042 unclassified probably benign
FR4976:H2-K1 UTSW 17 33997042 unclassified probably benign
R0254:H2-K1 UTSW 17 33996665 unclassified probably benign
R0520:H2-K1 UTSW 17 33997416 missense probably damaging 1.00
R0540:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R0607:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R1282:H2-K1 UTSW 17 33999447 missense probably damaging 1.00
R1785:H2-K1 UTSW 17 33997348 nonsense probably null
R2307:H2-K1 UTSW 17 33997139 missense probably benign 0.26
R3791:H2-K1 UTSW 17 33999525 missense probably benign 0.02
R3847:H2-K1 UTSW 17 33997329 missense probably damaging 1.00
R4008:H2-K1 UTSW 17 33999551 splice site probably benign
R4324:H2-K1 UTSW 17 34000040 missense possibly damaging 0.76
R4470:H2-K1 UTSW 17 34000061 missense probably benign 0.20
R4543:H2-K1 UTSW 17 33999558 splice site probably null
R4858:H2-K1 UTSW 17 33997324 missense probably benign 0.05
R4921:H2-K1 UTSW 17 33997076 missense possibly damaging 0.65
R5254:H2-K1 UTSW 17 33997462 missense probably damaging 1.00
R5269:H2-K1 UTSW 17 33997015 unclassified probably benign
R6058:H2-K1 UTSW 17 33999330 missense probably benign 0.02
R6058:H2-K1 UTSW 17 33999331 missense probably benign
R8057:H2-K1 UTSW 17 33996859 missense possibly damaging 0.63
Predicted Primers
Posted On2020-09-15