Incidental Mutation 'R7941:Pcdh1'
ID 649075
Institutional Source Beutler Lab
Gene Symbol Pcdh1
Ensembl Gene ENSMUSG00000051375
Gene Name protocadherin 1
Synonyms 2010005A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R7941 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 38185914-38212053 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38199080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 429 (D429G)
Ref Sequence ENSEMBL: ENSMUSP00000055199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057185] [ENSMUST00000159405] [ENSMUST00000160721] [ENSMUST00000161701] [ENSMUST00000193828] [ENSMUST00000194312]
AlphaFold Q8CFX3
Predicted Effect probably damaging
Transcript: ENSMUST00000057185
AA Change: D429G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055199
Gene: ENSMUSG00000051375
AA Change: D429G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159405
AA Change: D429G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125309
Gene: ENSMUSG00000051375
AA Change: D429G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160721
SMART Domains Protein: ENSMUSP00000124732
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 9.9e-10 PFAM
CA 168 256 5.18e-18 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161701
AA Change: D290G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125576
Gene: ENSMUSG00000051375
AA Change: D290G

DomainStartEndE-ValueType
CA 29 117 5.18e-18 SMART
CA 141 224 5.68e-24 SMART
CA 256 343 1.84e-23 SMART
CA 367 449 2.99e-32 SMART
CA 473 552 9.36e-25 SMART
CA 578 659 9.9e-15 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 737 764 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 903 914 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193828
SMART Domains Protein: ENSMUSP00000142328
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
low complexity region 18 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194312
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Pcdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdh1 APN 18 38198729 missense possibly damaging 0.65
IGL00919:Pcdh1 APN 18 38202812 nonsense probably null
IGL01744:Pcdh1 APN 18 38203249 missense probably damaging 1.00
PIT4260001:Pcdh1 UTSW 18 38203366 missense probably damaging 0.99
R0542:Pcdh1 UTSW 18 38189922 missense probably damaging 0.99
R1449:Pcdh1 UTSW 18 38189876 missense probably damaging 0.99
R1540:Pcdh1 UTSW 18 38189726 missense probably benign 0.01
R1642:Pcdh1 UTSW 18 38199230 missense possibly damaging 0.84
R1672:Pcdh1 UTSW 18 38192180 missense probably damaging 1.00
R1695:Pcdh1 UTSW 18 38202868 missense probably damaging 1.00
R1727:Pcdh1 UTSW 18 38203032 nonsense probably null
R1781:Pcdh1 UTSW 18 38189924 missense probably damaging 1.00
R1793:Pcdh1 UTSW 18 38198885 missense probably damaging 0.99
R1839:Pcdh1 UTSW 18 38199485 missense possibly damaging 0.82
R1843:Pcdh1 UTSW 18 38192225 splice site probably null
R1882:Pcdh1 UTSW 18 38202842 missense possibly damaging 0.49
R2261:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2262:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2263:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2511:Pcdh1 UTSW 18 38199479 missense possibly damaging 0.95
R2937:Pcdh1 UTSW 18 38189762 missense probably benign 0.40
R3941:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R3942:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R4057:Pcdh1 UTSW 18 38198897 missense probably damaging 0.98
R4155:Pcdh1 UTSW 18 38203106 missense probably damaging 0.99
R4169:Pcdh1 UTSW 18 38198305 missense probably damaging 1.00
R4617:Pcdh1 UTSW 18 38197860 missense probably benign 0.00
R4690:Pcdh1 UTSW 18 38203475 missense probably benign 0.33
R4825:Pcdh1 UTSW 18 38189859 missense possibly damaging 0.77
R5201:Pcdh1 UTSW 18 38198918 missense probably damaging 0.98
R5266:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5267:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5351:Pcdh1 UTSW 18 38197766 missense probably damaging 1.00
R5568:Pcdh1 UTSW 18 38197367 missense probably damaging 1.00
R5729:Pcdh1 UTSW 18 38202946 missense probably damaging 1.00
R5731:Pcdh1 UTSW 18 38198598 missense probably damaging 1.00
R6043:Pcdh1 UTSW 18 38203274 missense probably damaging 0.97
R6278:Pcdh1 UTSW 18 38199210 missense probably benign 0.29
R6333:Pcdh1 UTSW 18 38198807 missense probably benign 0.25
R6498:Pcdh1 UTSW 18 38197437 missense probably benign 0.18
R6937:Pcdh1 UTSW 18 38203475 missense possibly damaging 0.86
R6994:Pcdh1 UTSW 18 38198500 missense probably damaging 1.00
R7242:Pcdh1 UTSW 18 38203217 missense probably benign 0.06
R7289:Pcdh1 UTSW 18 38189913 missense probably damaging 0.99
R7391:Pcdh1 UTSW 18 38202785 missense possibly damaging 0.95
R7702:Pcdh1 UTSW 18 38203516 missense unknown
R7738:Pcdh1 UTSW 18 38197476 missense probably benign 0.02
R7849:Pcdh1 UTSW 18 38189609 missense probably benign 0.01
R8109:Pcdh1 UTSW 18 38198996 missense probably damaging 1.00
R8675:Pcdh1 UTSW 18 38199176 missense probably damaging 1.00
R8851:Pcdh1 UTSW 18 38192102 missense probably damaging 1.00
R8947:Pcdh1 UTSW 18 38199020 missense possibly damaging 0.89
R9443:Pcdh1 UTSW 18 38197580 missense probably damaging 1.00
R9448:Pcdh1 UTSW 18 38197439 missense probably damaging 1.00
X0027:Pcdh1 UTSW 18 38189788 nonsense probably null
Z1088:Pcdh1 UTSW 18 38198067 missense probably damaging 1.00
Z1176:Pcdh1 UTSW 18 38198688 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCACTTCACCAGGCTTGTTG -3'
(R):5'- CATAGGGCTGGTGACTCATCAAG -3'

Sequencing Primer
(F):5'- GCAACTTCAGTGATGCTCTG -3'
(R):5'- TCAAGACGGAATGGCTAACATATC -3'
Posted On 2020-09-15