Incidental Mutation 'R7941:Dagla'
ID649078
Institutional Source Beutler Lab
Gene Symbol Dagla
Ensembl Gene ENSMUSG00000035735
Gene Namediacylglycerol lipase, alpha
SynonymsNsddr
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10245265-10304877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10271503 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 29 (H29R)
Ref Sequence ENSEMBL: ENSMUSP00000046358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039327] [ENSMUST00000125567]
Predicted Effect probably damaging
Transcript: ENSMUST00000039327
AA Change: H29R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046358
Gene: ENSMUSG00000035735
AA Change: H29R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Pfam:Lipase_3 394 533 1.3e-12 PFAM
low complexity region 616 625 N/A INTRINSIC
low complexity region 699 717 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
low complexity region 980 1002 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125567
AA Change: H29R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138702
Gene: ENSMUSG00000035735
AA Change: H29R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a diacylglycerol lipase. The encoded enzyme is involved in the biosynthesis of the endocannabinoid 2-arachidonoyl-glycerol.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for null mutations have decreased body weight, adult neuronal proliferation, and nervous system endocannaboid levels and abnormal inhibitory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Dagla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Dagla APN 19 10248520 missense possibly damaging 0.51
IGL01625:Dagla APN 19 10251202 splice site probably benign
IGL01697:Dagla APN 19 10271198 missense probably benign 0.01
IGL01940:Dagla APN 19 10252171 missense probably benign
IGL02330:Dagla APN 19 10248022 missense probably damaging 1.00
PIT4480001:Dagla UTSW 19 10260658 missense probably benign 0.02
R0541:Dagla UTSW 19 10254806 critical splice donor site probably null
R0610:Dagla UTSW 19 10271558 missense probably damaging 1.00
R0638:Dagla UTSW 19 10254883 missense probably damaging 0.97
R0653:Dagla UTSW 19 10248425 missense probably damaging 1.00
R1675:Dagla UTSW 19 10269323 missense probably benign 0.00
R1822:Dagla UTSW 19 10263186 missense possibly damaging 0.94
R1830:Dagla UTSW 19 10271014 missense probably benign 0.44
R2303:Dagla UTSW 19 10252103 missense probably damaging 1.00
R2568:Dagla UTSW 19 10248152 missense probably benign
R2879:Dagla UTSW 19 10271084 missense possibly damaging 0.93
R2902:Dagla UTSW 19 10248103 missense probably damaging 0.99
R2939:Dagla UTSW 19 10256364 missense probably damaging 1.00
R3771:Dagla UTSW 19 10248467 missense possibly damaging 0.89
R4176:Dagla UTSW 19 10263097 missense probably damaging 1.00
R4255:Dagla UTSW 19 10256952 nonsense probably null
R4519:Dagla UTSW 19 10269732 missense probably damaging 1.00
R4584:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4586:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4614:Dagla UTSW 19 10248277 missense probably damaging 1.00
R4751:Dagla UTSW 19 10250394 missense probably benign 0.00
R4933:Dagla UTSW 19 10269715 critical splice donor site probably null
R5844:Dagla UTSW 19 10271125 missense probably damaging 1.00
R5858:Dagla UTSW 19 10254968 intron probably benign
R5958:Dagla UTSW 19 10248424 missense probably damaging 1.00
R6628:Dagla UTSW 19 10263227 missense probably damaging 1.00
R6799:Dagla UTSW 19 10256850 missense probably damaging 1.00
R7072:Dagla UTSW 19 10256295 critical splice donor site probably null
R7253:Dagla UTSW 19 10262581 splice site probably null
R7451:Dagla UTSW 19 10253355 missense probably damaging 1.00
R7654:Dagla UTSW 19 10248206 missense probably benign 0.01
R7980:Dagla UTSW 19 10252042 missense possibly damaging 0.82
R8293:Dagla UTSW 19 10252037 critical splice donor site probably null
R8327:Dagla UTSW 19 10251087 missense probably benign 0.11
R8442:Dagla UTSW 19 10263092 critical splice donor site probably null
R8442:Dagla UTSW 19 10271519 missense probably damaging 0.99
X0021:Dagla UTSW 19 10271164 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGATGTGCCCGACTGTC -3'
(R):5'- AAGATGCCTACCACACCTGG -3'

Sequencing Primer
(F):5'- GAGGCATCGGCAGTAACTACTAC -3'
(R):5'- TGGTAGTAGCCCAGACTATTCCAG -3'
Posted On2020-09-15