Incidental Mutation 'R7942:Aox2'
ID 649081
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7942 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58337431 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 924 (T924A)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably damaging
Transcript: ENSMUST00000114366
AA Change: T924A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: T924A

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A G 8: 11,655,615 I164T unknown Het
Abcg3 A G 5: 104,939,161 I565T probably damaging Het
Adamts8 G A 9: 30,953,482 C423Y probably damaging Het
Adamts8 G A 9: 30,958,913 probably null Het
Ahctf1 A C 1: 179,786,095 V490G possibly damaging Het
Akap13 A G 7: 75,611,470 T478A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ano9 T C 7: 141,104,076 S559G probably damaging Het
Atp13a1 A G 8: 69,807,220 E1126G probably damaging Het
Bcan A G 3: 87,993,075 V617A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldnd1 A T 16: 58,729,715 N87I possibly damaging Het
Enpp2 A T 15: 54,845,879 V784E probably damaging Het
Eps8 T A 6: 137,530,577 Y51F possibly damaging Het
Fam184b T C 5: 45,584,253 K212R probably benign Het
Fbn1 A C 2: 125,412,786 C186G possibly damaging Het
Fsip1 G A 2: 118,136,611 T411I probably benign Het
Glyr1 T C 16: 5,018,921 T460A probably benign Het
Gm19410 G A 8: 35,771,786 G70R probably damaging Het
Gna15 G A 10: 81,523,911 T15I probably damaging Het
Heg1 T C 16: 33,751,200 C1198R probably damaging Het
Hoxd1 A G 2: 74,764,160 Y253C probably damaging Het
Il17re G T 6: 113,466,150 Q316H probably damaging Het
Jakmip1 C A 5: 37,173,838 P621T probably benign Het
Krt71 T C 15: 101,735,459 Y448C probably damaging Het
Lgals8 A G 13: 12,453,256 probably null Het
March11 A G 15: 26,409,419 *401W probably null Het
Mctp1 A T 13: 76,641,710 probably null Het
Mms19 C A 19: 41,955,961 V310F probably damaging Het
Mycbp2 A T 14: 103,155,238 F3296I probably damaging Het
Myo7b A T 18: 32,013,369 I121N probably damaging Het
Nr0b2 T C 4: 133,553,536 S38P probably benign Het
Nudt16l1 T A 16: 4,939,379 M52K probably benign Het
Olfr1079 T C 2: 86,538,222 N229S probably benign Het
Olfr399 A G 11: 74,054,228 I177T probably damaging Het
Polr3gl A T 3: 96,582,236 probably null Het
Ptch2 T A 4: 117,106,001 F228L probably benign Het
Slc35d1 A G 4: 103,213,163 probably null Het
Slc41a1 G A 1: 131,840,897 V198I probably damaging Het
Slc5a7 T C 17: 54,276,681 D527G possibly damaging Het
Spag16 G T 1: 69,827,088 A29S probably benign Het
Speer4f2 T A 5: 17,377,632 D284E unknown Het
Sspo A G 6: 48,488,500 probably null Het
Tdpoz1 T C 3: 93,671,210 K89R possibly damaging Het
Tek C T 4: 94,851,874 probably null Het
Tet3 C T 6: 83,376,974 V902M probably damaging Het
Tpcn2 C T 7: 145,257,191 V590M probably damaging Het
Trcg1 T C 9: 57,242,216 V357A probably benign Het
Tspan18 A G 2: 93,210,858 V133A probably benign Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Vmn2r95 T A 17: 18,440,267 L314I possibly damaging Het
Wdsub1 G A 2: 59,876,717 A178V probably damaging Het
Zfp407 A G 18: 84,559,629 S1120P probably benign Het
Zfp57 T C 17: 37,009,674 F140S probably damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCAAAATGTCTAGTTGTGTAAACGT -3'
(R):5'- GTGCAGTTGTTCTAGTGTTCCC -3'

Sequencing Primer
(F):5'- ACACACTCTTGGGATTCACAGTG -3'
(R):5'- CCTGGGGCTGCTAGCTAATTC -3'
Posted On 2020-09-15