Incidental Mutation 'R7942:Spag16'
ID649082
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R7942 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69827088 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 29 (A29S)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably benign
Transcript: ENSMUST00000065425
AA Change: A29S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: A29S

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113940
AA Change: A29S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: A29S

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A G 8: 11,655,615 I164T unknown Het
Abcg3 A G 5: 104,939,161 I565T probably damaging Het
Adamts8 G A 9: 30,953,482 C423Y probably damaging Het
Adamts8 G A 9: 30,958,913 probably null Het
Ahctf1 A C 1: 179,786,095 V490G possibly damaging Het
Akap13 A G 7: 75,611,470 T478A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ano9 T C 7: 141,104,076 S559G probably damaging Het
Aox2 A G 1: 58,337,431 T924A probably damaging Het
Atp13a1 A G 8: 69,807,220 E1126G probably damaging Het
Bcan A G 3: 87,993,075 V617A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldnd1 A T 16: 58,729,715 N87I possibly damaging Het
Enpp2 A T 15: 54,845,879 V784E probably damaging Het
Eps8 T A 6: 137,530,577 Y51F possibly damaging Het
Fam184b T C 5: 45,584,253 K212R probably benign Het
Fbn1 A C 2: 125,412,786 C186G possibly damaging Het
Fsip1 G A 2: 118,136,611 T411I probably benign Het
Glyr1 T C 16: 5,018,921 T460A probably benign Het
Gm19410 G A 8: 35,771,786 G70R probably damaging Het
Gna15 G A 10: 81,523,911 T15I probably damaging Het
Heg1 T C 16: 33,751,200 C1198R probably damaging Het
Hoxd1 A G 2: 74,764,160 Y253C probably damaging Het
Il17re G T 6: 113,466,150 Q316H probably damaging Het
Jakmip1 C A 5: 37,173,838 P621T probably benign Het
Krt71 T C 15: 101,735,459 Y448C probably damaging Het
Lgals8 A G 13: 12,453,256 probably null Het
March11 A G 15: 26,409,419 *401W probably null Het
Mctp1 A T 13: 76,641,710 probably null Het
Mms19 C A 19: 41,955,961 V310F probably damaging Het
Mycbp2 A T 14: 103,155,238 F3296I probably damaging Het
Myo7b A T 18: 32,013,369 I121N probably damaging Het
Nr0b2 T C 4: 133,553,536 S38P probably benign Het
Nudt16l1 T A 16: 4,939,379 M52K probably benign Het
Olfr1079 T C 2: 86,538,222 N229S probably benign Het
Olfr399 A G 11: 74,054,228 I177T probably damaging Het
Ptch2 T A 4: 117,106,001 F228L probably benign Het
Slc35d1 A G 4: 103,213,163 probably null Het
Slc41a1 G A 1: 131,840,897 V198I probably damaging Het
Slc5a7 T C 17: 54,276,681 D527G possibly damaging Het
Speer4f2 T A 5: 17,377,632 D284E unknown Het
Tdpoz1 T C 3: 93,671,210 K89R possibly damaging Het
Tet3 C T 6: 83,376,974 V902M probably damaging Het
Tpcn2 C T 7: 145,257,191 V590M probably damaging Het
Trcg1 T C 9: 57,242,216 V357A probably benign Het
Tspan18 A G 2: 93,210,858 V133A probably benign Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Vmn2r95 T A 17: 18,440,267 L314I possibly damaging Het
Wdsub1 G A 2: 59,876,717 A178V probably damaging Het
Zfp407 A G 18: 84,559,629 S1120P probably benign Het
Zfp57 T C 17: 37,009,674 F140S probably damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 splice site probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 splice site probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8132:Spag16 UTSW 1 70381302 missense probably damaging 1.00
R8329:Spag16 UTSW 1 69895248 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCGTTGCCGTAGTAACTG -3'
(R):5'- TAAAATGGCTTCTGCTGGGAC -3'

Sequencing Primer
(F):5'- TAGTAACTGCGGACGCGC -3'
(R):5'- CAGAGCTGGGCTGGCAAG -3'
Posted On2020-09-15