Incidental Mutation 'R7942:Speer4f2'
ID 649098
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Name spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms Gm3535, Gm3495
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7942 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 17373180-17378028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17377632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 284 (D284E)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
AlphaFold E9Q366
Predicted Effect unknown
Transcript: ENSMUST00000166086
AA Change: D284E
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: D284E

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A G 8: 11,655,615 I164T unknown Het
Abcg3 A G 5: 104,939,161 I565T probably damaging Het
Adamts8 G A 9: 30,953,482 C423Y probably damaging Het
Adamts8 G A 9: 30,958,913 probably null Het
Ahctf1 A C 1: 179,786,095 V490G possibly damaging Het
Akap13 A G 7: 75,611,470 T478A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ano9 T C 7: 141,104,076 S559G probably damaging Het
Aox2 A G 1: 58,337,431 T924A probably damaging Het
Atp13a1 A G 8: 69,807,220 E1126G probably damaging Het
Bcan A G 3: 87,993,075 V617A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldnd1 A T 16: 58,729,715 N87I possibly damaging Het
Enpp2 A T 15: 54,845,879 V784E probably damaging Het
Eps8 T A 6: 137,530,577 Y51F possibly damaging Het
Fam184b T C 5: 45,584,253 K212R probably benign Het
Fbn1 A C 2: 125,412,786 C186G possibly damaging Het
Fsip1 G A 2: 118,136,611 T411I probably benign Het
Glyr1 T C 16: 5,018,921 T460A probably benign Het
Gm19410 G A 8: 35,771,786 G70R probably damaging Het
Gna15 G A 10: 81,523,911 T15I probably damaging Het
Heg1 T C 16: 33,751,200 C1198R probably damaging Het
Hoxd1 A G 2: 74,764,160 Y253C probably damaging Het
Il17re G T 6: 113,466,150 Q316H probably damaging Het
Jakmip1 C A 5: 37,173,838 P621T probably benign Het
Krt71 T C 15: 101,735,459 Y448C probably damaging Het
Lgals8 A G 13: 12,453,256 probably null Het
March11 A G 15: 26,409,419 *401W probably null Het
Mctp1 A T 13: 76,641,710 probably null Het
Mms19 C A 19: 41,955,961 V310F probably damaging Het
Mycbp2 A T 14: 103,155,238 F3296I probably damaging Het
Myo7b A T 18: 32,013,369 I121N probably damaging Het
Nr0b2 T C 4: 133,553,536 S38P probably benign Het
Nudt16l1 T A 16: 4,939,379 M52K probably benign Het
Olfr1079 T C 2: 86,538,222 N229S probably benign Het
Olfr399 A G 11: 74,054,228 I177T probably damaging Het
Polr3gl A T 3: 96,582,236 probably null Het
Ptch2 T A 4: 117,106,001 F228L probably benign Het
Slc35d1 A G 4: 103,213,163 probably null Het
Slc41a1 G A 1: 131,840,897 V198I probably damaging Het
Slc5a7 T C 17: 54,276,681 D527G possibly damaging Het
Spag16 G T 1: 69,827,088 A29S probably benign Het
Sspo A G 6: 48,488,500 probably null Het
Tdpoz1 T C 3: 93,671,210 K89R possibly damaging Het
Tek C T 4: 94,851,874 probably null Het
Tet3 C T 6: 83,376,974 V902M probably damaging Het
Tpcn2 C T 7: 145,257,191 V590M probably damaging Het
Trcg1 T C 9: 57,242,216 V357A probably benign Het
Tspan18 A G 2: 93,210,858 V133A probably benign Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Vmn2r95 T A 17: 18,440,267 L314I possibly damaging Het
Wdsub1 G A 2: 59,876,717 A178V probably damaging Het
Zfp407 A G 18: 84,559,629 S1120P probably benign Het
Zfp57 T C 17: 37,009,674 F140S probably damaging Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17376567 missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17376629 nonsense probably null
IGL03100:Speer4f2 APN 5 17376530 missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17374404 missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17376542 missense
R1873:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R3608:Speer4f2 UTSW 5 17374494 missense probably benign 0.03
R4972:Speer4f2 UTSW 5 17374425 missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17374358 missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17373219 missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17376500 missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17376528 missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17376624 missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17374433 missense probably damaging 0.99
R6553:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6585:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17375769 missense probably benign 0.05
R6878:Speer4f2 UTSW 5 17375767 missense probably damaging 0.99
R7089:Speer4f2 UTSW 5 17376663 missense
R7129:Speer4f2 UTSW 5 17377448 missense
R7448:Speer4f2 UTSW 5 17376542 missense
R7654:Speer4f2 UTSW 5 17374415 missense
R8170:Speer4f2 UTSW 5 17374461 missense
R8409:Speer4f2 UTSW 5 17377421 missense
R9154:Speer4f2 UTSW 5 17376612 missense
Predicted Primers PCR Primer
(F):5'- TGGGATTGGCCACAGATCAAG -3'
(R):5'- TTTTAGCAGCACAGACCTACAG -3'

Sequencing Primer
(F):5'- TGCAGGATGAGTTGCCAC -3'
(R):5'- GCACAGACCTACAGCCTGC -3'
Posted On 2020-09-15