Mutagenetix > Incidental Mutation

Incidental Mutation 'R7942:Vmn2r95'

649127

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r95

Ensembl Gene

ENSMUSG00000091631

Gene Name

vomeronasal 2, receptor 95

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R7942 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18424078-18460905 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18440267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 314 (L314I)

Ref Sequence

ENSEMBL: ENSMUSP00000126106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]

AlphaFold

A0A338P6T0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166327
AA Change: L314I

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: L314I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	462	1.8e-35	PFAM
Pfam:NCD3G	509	562	3.2e-20	PFAM
Pfam:7tm_3	594	830	3.2e-51	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232090
AA Change: L314I

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000232464
AA Change: L314I

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	A	G	8: 11,655,615	I164T	unknown	Het
Abcg3	A	G	5: 104,939,161	I565T	probably damaging	Het
Adamts8	G	A	9: 30,953,482	C423Y	probably damaging	Het
Adamts8	G	A	9: 30,958,913		probably null	Het
Ahctf1	A	C	1: 179,786,095	V490G	possibly damaging	Het
Akap13	A	G	7: 75,611,470	T478A	possibly damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Ano9	T	C	7: 141,104,076	S559G	probably damaging	Het
Aox2	A	G	1: 58,337,431	T924A	probably damaging	Het
Atp13a1	A	G	8: 69,807,220	E1126G	probably damaging	Het
Bcan	A	G	3: 87,993,075	V617A	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cldnd1	A	T	16: 58,729,715	N87I	possibly damaging	Het
Enpp2	A	T	15: 54,845,879	V784E	probably damaging	Het
Eps8	T	A	6: 137,530,577	Y51F	possibly damaging	Het
Fam184b	T	C	5: 45,584,253	K212R	probably benign	Het
Fbn1	A	C	2: 125,412,786	C186G	possibly damaging	Het
Fsip1	G	A	2: 118,136,611	T411I	probably benign	Het
Glyr1	T	C	16: 5,018,921	T460A	probably benign	Het
Gm19410	G	A	8: 35,771,786	G70R	probably damaging	Het
Gna15	G	A	10: 81,523,911	T15I	probably damaging	Het
Heg1	T	C	16: 33,751,200	C1198R	probably damaging	Het
Hoxd1	A	G	2: 74,764,160	Y253C	probably damaging	Het
Il17re	G	T	6: 113,466,150	Q316H	probably damaging	Het
Jakmip1	C	A	5: 37,173,838	P621T	probably benign	Het
Krt71	T	C	15: 101,735,459	Y448C	probably damaging	Het
Lgals8	A	G	13: 12,453,256		probably null	Het
March11	A	G	15: 26,409,419	*401W	probably null	Het
Mctp1	A	T	13: 76,641,710		probably null	Het
Mms19	C	A	19: 41,955,961	V310F	probably damaging	Het
Mycbp2	A	T	14: 103,155,238	F3296I	probably damaging	Het
Myo7b	A	T	18: 32,013,369	I121N	probably damaging	Het
Nr0b2	T	C	4: 133,553,536	S38P	probably benign	Het
Nudt16l1	T	A	16: 4,939,379	M52K	probably benign	Het
Olfr1079	T	C	2: 86,538,222	N229S	probably benign	Het
Olfr399	A	G	11: 74,054,228	I177T	probably damaging	Het
Polr3gl	A	T	3: 96,582,236		probably null	Het
Ptch2	T	A	4: 117,106,001	F228L	probably benign	Het
Slc35d1	A	G	4: 103,213,163		probably null	Het
Slc41a1	G	A	1: 131,840,897	V198I	probably damaging	Het
Slc5a7	T	C	17: 54,276,681	D527G	possibly damaging	Het
Spag16	G	T	1: 69,827,088	A29S	probably benign	Het
Speer4f2	T	A	5: 17,377,632	D284E	unknown	Het
Sspo	A	G	6: 48,488,500		probably null	Het
Tdpoz1	T	C	3: 93,671,210	K89R	possibly damaging	Het
Tek	C	T	4: 94,851,874		probably null	Het
Tet3	C	T	6: 83,376,974	V902M	probably damaging	Het
Tpcn2	C	T	7: 145,257,191	V590M	probably damaging	Het
Trcg1	T	C	9: 57,242,216	V357A	probably benign	Het
Tspan18	A	G	2: 93,210,858	V133A	probably benign	Het
Unc5b	A	T	10: 60,777,543	W305R	probably damaging	Het
Wdsub1	G	A	2: 59,876,717	A178V	probably damaging	Het
Zfp407	A	G	18: 84,559,629	S1120P	probably benign	Het
Zfp57	T	C	17: 37,009,674	F140S	probably damaging	Het

Other mutations in Vmn2r95

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Vmn2r95	APN	17	18452328	utr 3 prime	probably benign
IGL01479:Vmn2r95	APN	17	18443862	missense	probably damaging	1.00
IGL01890:Vmn2r95	APN	17	18451475	missense	probably damaging	1.00
IGL01986:Vmn2r95	APN	17	18440211	missense	probably benign	0.06
IGL02113:Vmn2r95	APN	17	18439907	missense	possibly damaging	0.47
IGL02154:Vmn2r95	APN	17	18451986	missense	probably benign	0.16
IGL02190:Vmn2r95	APN	17	18451776	missense	probably benign	0.00
IGL02412:Vmn2r95	APN	17	18439956	missense	probably damaging	1.00
IGL02550:Vmn2r95	APN	17	18451732	missense	probably damaging	1.00
IGL02679:Vmn2r95	APN	17	18443854	missense	probably damaging	1.00
IGL02691:Vmn2r95	APN	17	18451858	missense	probably benign	0.07
IGL02990:Vmn2r95	APN	17	18452036	nonsense	probably null
IGL03032:Vmn2r95	APN	17	18452313	missense	probably benign	0.00
R0416:Vmn2r95	UTSW	17	18441402	missense	probably damaging	1.00
R0448:Vmn2r95	UTSW	17	18451743	missense	possibly damaging	0.92
R0514:Vmn2r95	UTSW	17	18451582	missense	probably benign
R0519:Vmn2r95	UTSW	17	18439503	missense	probably damaging	1.00
R0539:Vmn2r95	UTSW	17	18452100	missense	probably damaging	1.00
R1501:Vmn2r95	UTSW	17	18439856	missense	probably damaging	0.99
R1598:Vmn2r95	UTSW	17	18452313	missense	probably benign	0.03
R1613:Vmn2r95	UTSW	17	18440639	splice site	probably benign
R1861:Vmn2r95	UTSW	17	18452268	missense	probably damaging	1.00
R1921:Vmn2r95	UTSW	17	18424313	missense	probably benign	0.11
R1986:Vmn2r95	UTSW	17	18451543	missense	probably benign
R2031:Vmn2r95	UTSW	17	18439455	missense	possibly damaging	0.94
R2040:Vmn2r95	UTSW	17	18441299	missense	probably damaging	1.00
R3608:Vmn2r95	UTSW	17	18439973	missense	possibly damaging	0.47
R3727:Vmn2r95	UTSW	17	18441482	nonsense	probably null
R3953:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R3955:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R3957:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R4474:Vmn2r95	UTSW	17	18452245	missense	probably damaging	1.00
R4672:Vmn2r95	UTSW	17	18452151	missense	probably damaging	1.00
R4850:Vmn2r95	UTSW	17	18451653	missense	probably damaging	1.00
R5054:Vmn2r95	UTSW	17	18451446	missense	possibly damaging	0.63
R5178:Vmn2r95	UTSW	17	18440075	missense	probably benign	0.01
R5980:Vmn2r95	UTSW	17	18441362	missense	probably benign
R6183:Vmn2r95	UTSW	17	18443930	missense	probably damaging	0.99
R6276:Vmn2r95	UTSW	17	18451470	missense	possibly damaging	0.96
R6651:Vmn2r95	UTSW	17	18440360	missense	probably damaging	1.00
R6682:Vmn2r95	UTSW	17	18440227	missense	probably damaging	1.00
R6797:Vmn2r95	UTSW	17	18452289	utr 3 prime	probably benign
R6799:Vmn2r95	UTSW	17	18439293	missense	probably damaging	1.00
R6849:Vmn2r95	UTSW	17	18443919	missense	probably damaging	1.00
R6849:Vmn2r95	UTSW	17	18443920	missense	probably damaging	1.00
R6982:Vmn2r95	UTSW	17	18452061	missense	probably damaging	1.00
R7203:Vmn2r95	UTSW	17	18441315	missense	probably benign	0.01
R7226:Vmn2r95	UTSW	17	18451983	missense	possibly damaging	0.90
R7240:Vmn2r95	UTSW	17	18451963	missense	probably benign	0.15
R7383:Vmn2r95	UTSW	17	18440472	missense	probably benign	0.06
R7614:Vmn2r95	UTSW	17	18440090	missense	probably benign
R7755:Vmn2r95	UTSW	17	18424105	start codon destroyed	probably null	0.99
R8355:Vmn2r95	UTSW	17	18440090	missense	probably benign
R8455:Vmn2r95	UTSW	17	18440090	missense	probably benign
R8478:Vmn2r95	UTSW	17	18452282	missense	probably damaging	1.00
R8547:Vmn2r95	UTSW	17	18443899	missense	probably damaging	1.00
R8752:Vmn2r95	UTSW	17	18441476	missense	probably damaging	0.98
R8788:Vmn2r95	UTSW	17	18451528	missense	probably benign	0.09
R8852:Vmn2r95	UTSW	17	18443851	missense	possibly damaging	0.95
R9098:Vmn2r95	UTSW	17	18439905	missense	possibly damaging	0.88
R9202:Vmn2r95	UTSW	17	18424132	missense	probably benign	0.00
R9244:Vmn2r95	UTSW	17	18451927	missense	possibly damaging	0.91
R9546:Vmn2r95	UTSW	17	18441459	missense	probably benign	0.01
R9665:Vmn2r95	UTSW	17	18440345	missense	probably damaging	0.99
Z1088:Vmn2r95	UTSW	17	18440401	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACCTCAGAAACATGGACTTC -3'
(R):5'- ACATCCAAAGAAGCATTGGTTTGAC -3'

Sequencing Primer
(F):5'- TCACTAGAAGGTGTAATGAGGA -3'
(R):5'- AGAAGCATTGGTTTGACAGTTTTCC -3'

Posted On

2020-09-15