Incidental Mutation 'R7943:Cd4'
ID649152
Institutional Source Beutler Lab
Gene Symbol Cd4
Ensembl Gene ENSMUSG00000023274
Gene NameCD4 antigen
SynonymsL3T4, Ly-4
MMRRC Submission
Accession Numbers

Genbank: NM_013488; MGI: 88335

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7943 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124864692-124888221 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 124870244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024044]
Predicted Effect probably null
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

 All alleles(25) : Targeted(13) Gene trapped(6) Spontaneous(2) Chemically induced(4)          

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,686,222 T205I probably benign Het
Acsbg1 T C 9: 54,622,737 H225R probably damaging Het
Anks1 T A 17: 27,985,204 Y209N probably damaging Het
Appl1 T A 14: 26,945,568 I377L probably benign Het
Arl9 A T 5: 77,010,548 D159V probably damaging Het
Arsa A C 15: 89,474,089 L339R probably damaging Het
C2 A G 17: 34,872,378 L380P probably damaging Het
Ccdc13 A G 9: 121,799,130 C97R unknown Het
Ccdc74a A G 16: 17,650,552 H346R probably benign Het
Ccnl1 T C 3: 65,956,905 I152V probably benign Het
Ceacam5 A T 7: 17,745,566 I203L probably benign Het
Ckap2 C A 8: 22,175,074 R458L probably damaging Het
Cldn10 T C 14: 118,861,859 probably null Het
Col27a1 C T 4: 63,318,283 R1377C unknown Het
Cry1 A T 10: 85,143,120 M514K probably benign Het
Crybg2 T G 4: 134,072,984 V176G probably damaging Het
Cyp2j5 C T 4: 96,659,612 G131D possibly damaging Het
Ddx46 A G 13: 55,669,722 Y720C probably damaging Het
Dock10 A T 1: 80,648,289 V44D probably damaging Het
Enam A T 5: 88,488,551 probably null Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam184a C T 10: 53,647,041 A956T probably damaging Het
Fbxw10 A T 11: 62,850,661 R202* probably null Het
Fnip1 A G 11: 54,502,388 E550G probably damaging Het
Gm37596 A T 3: 93,692,763 C100S probably benign Het
Gm8300 C T 12: 87,517,003 A36V probably damaging Het
Gpr149 A G 3: 62,530,711 L675P probably damaging Het
Hivep3 T C 4: 120,132,357 Y2002H probably benign Het
Hp A G 8: 109,575,555 Y254H probably damaging Het
Ighg1 G T 12: 113,330,337 T62N Het
Jcad A G 18: 4,672,700 E154G probably damaging Het
Kmt2a A G 9: 44,849,140 S471P probably damaging Het
Med13 A G 11: 86,278,526 V1968A probably damaging Het
Mknk2 T A 10: 80,675,867 Q3L probably benign Het
Nup98 G A 7: 102,194,822 T65I probably benign Het
Olfr1028 A G 2: 85,951,998 T312A probably benign Het
Olfr1499 A T 19: 13,815,236 M118K probably damaging Het
Olfr585 G A 7: 103,097,946 M68I probably damaging Het
Olfr763 T A 10: 129,012,065 M260K possibly damaging Het
Pcdhgb4 C T 18: 37,722,010 T486I probably benign Het
Perm1 T A 4: 156,218,534 F512I probably damaging Het
Pgap3 A T 11: 98,390,401 L262Q probably damaging Het
Pklr A C 3: 89,141,507 Y126S probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppm1k T C 6: 57,524,828 T117A probably benign Het
Prkd2 G A 7: 16,850,319 E366K probably benign Het
Psd C A 19: 46,324,730 C67F possibly damaging Het
Ptpa T A 2: 30,432,044 F100L probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rock1 T C 18: 10,112,357 E466G probably damaging Het
Sec16b A T 1: 157,554,757 M588L probably benign Het
Serpina1f T A 12: 103,693,690 H111L probably damaging Het
Sf3a1 T C 11: 4,166,537 I76T possibly damaging Het
Shcbp1 A T 8: 4,748,812 L369Q possibly damaging Het
Spef2 A G 15: 9,601,085 M1697T unknown Het
St7 G A 6: 17,844,912 C133Y probably damaging Het
Tex19.1 T A 11: 121,147,160 W115R possibly damaging Het
Tfrc T A 16: 32,630,221 I726N probably benign Het
Thbs1 A G 2: 118,119,617 probably null Het
Trim43a C T 9: 88,582,185 P50S probably benign Het
Trpm4 A T 7: 45,308,681 V935E probably damaging Het
Ttc12 A T 9: 49,470,320 V117D possibly damaging Het
Ulbp1 T C 10: 7,457,053 T82A probably damaging Het
Usp13 C T 3: 32,876,940 H288Y probably damaging Het
Vmn2r82 A G 10: 79,396,245 K693E possibly damaging Het
Vmn2r90 A G 17: 17,712,304 T158A probably damaging Het
Vps8 A G 16: 21,477,872 K540R possibly damaging Het
Zfp143 T A 7: 110,072,474 probably null Het
Zfp709 G T 8: 71,890,089 C454F probably damaging Het
Other mutations in Cd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTCAGAGCCAGCTCAGG -3'
(R):5'- TGTCCGTACAAAAGTCCACC -3'

Sequencing Primer
(F):5'- CTGCTCAGCAATAGAGTTTGTAC -3'
(R):5'- GTCCGTACAAAAGTCCACCAAAGAC -3'
Posted On2020-09-15