Incidental Mutation 'R0015:Ndrg2'
ID64916
Institutional Source Beutler Lab
Gene Symbol Ndrg2
Ensembl Gene ENSMUSG00000004558
Gene NameN-myc downstream regulated gene 2
SynonymsNdr2
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R0015 (G1)
Quality Score150
Status Validated
Chromosome14
Chromosomal Location51905271-51914158 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 51910445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004673] [ENSMUST00000111632] [ENSMUST00000226184] [ENSMUST00000226528] [ENSMUST00000227237] [ENSMUST00000227402] [ENSMUST00000228164]
Predicted Effect probably benign
Transcript: ENSMUST00000004673
SMART Domains Protein: ENSMUSP00000004673
Gene: ENSMUSG00000004558

DomainStartEndE-ValueType
Pfam:Ndr 40 318 5.4e-125 PFAM
low complexity region 323 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111632
SMART Domains Protein: ENSMUSP00000107259
Gene: ENSMUSG00000004558

DomainStartEndE-ValueType
Pfam:Ndr 26 304 4.7e-125 PFAM
Pfam:Abhydrolase_6 58 292 7.6e-11 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226122
Predicted Effect probably benign
Transcript: ENSMUST00000226184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226366
Predicted Effect probably benign
Transcript: ENSMUST00000226528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226698
Predicted Effect probably benign
Transcript: ENSMUST00000227237
Predicted Effect probably benign
Transcript: ENSMUST00000227402
Predicted Effect probably benign
Transcript: ENSMUST00000228164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228620
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele develop various types of tumors, including T-cell lymphomas, and have a shorter lifespan. Homozygotes for a second null allele show vertebral transformations. Homozygotes for a third null allele show reduced astrogliosis and inflammatory response after brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Ndrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Ndrg2 APN 14 51911109 missense probably damaging 0.99
IGL02645:Ndrg2 APN 14 51906522 missense possibly damaging 0.87
IGL03226:Ndrg2 APN 14 51906569 unclassified probably benign
R0015:Ndrg2 UTSW 14 51910445 splice site probably benign
R0197:Ndrg2 UTSW 14 51907003 unclassified probably benign
R0606:Ndrg2 UTSW 14 51906217 missense probably damaging 1.00
R0812:Ndrg2 UTSW 14 51908662 splice site probably benign
R1449:Ndrg2 UTSW 14 51908134 missense probably damaging 1.00
R1625:Ndrg2 UTSW 14 51906963 missense probably damaging 1.00
R3803:Ndrg2 UTSW 14 51910675 splice site probably null
R5242:Ndrg2 UTSW 14 51911084 critical splice donor site probably null
R5424:Ndrg2 UTSW 14 51908885 missense probably damaging 0.97
R5568:Ndrg2 UTSW 14 51906963 missense probably damaging 1.00
R5703:Ndrg2 UTSW 14 51910122 critical splice acceptor site probably null
R6711:Ndrg2 UTSW 14 51910325 missense possibly damaging 0.94
R7515:Ndrg2 UTSW 14 51908923 missense probably benign 0.40
R7689:Ndrg2 UTSW 14 51910355 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAAGGACTCCTGAAGCCTCTCAC -3'
(R):5'- CCGGCGATATTCACCTACCATGATG -3'

Sequencing Primer
(F):5'- ATCATGTCAGCAAGCTGGTC -3'
(R):5'- ATTCACCTACCATGATGTAGGC -3'
Posted On2013-08-06