Incidental Mutation 'R7943:Sf3a1'
ID649173
Institutional Source Beutler Lab
Gene Symbol Sf3a1
Ensembl Gene ENSMUSG00000002129
Gene Namesplicing factor 3a, subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7943 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4160350-4182541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4166537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 76 (I76T)
Ref Sequence ENSEMBL: ENSMUSP00000002198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002198]
PDB Structure
Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002198
AA Change: I76T

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129
AA Change: I76T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SWAP 50 103 4.99e-30 SMART
low complexity region 118 138 N/A INTRINSIC
SWAP 164 217 3.22e-24 SMART
Pfam:PRP21_like_P 227 469 7e-81 PFAM
low complexity region 552 560 N/A INTRINSIC
low complexity region 574 589 N/A INTRINSIC
low complexity region 624 673 N/A INTRINSIC
UBQ 713 784 6.52e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcb1a C T 5: 8,686,222 T205I probably benign Het
Acsbg1 T C 9: 54,622,737 H225R probably damaging Het
Anks1 T A 17: 27,985,204 Y209N probably damaging Het
Appl1 T A 14: 26,945,568 I377L probably benign Het
Arl9 A T 5: 77,010,548 D159V probably damaging Het
Arsa A C 15: 89,474,089 L339R probably damaging Het
C2 A G 17: 34,872,378 L380P probably damaging Het
Ccdc74a A G 16: 17,650,552 H346R probably benign Het
Ccnl1 T C 3: 65,956,905 I152V probably benign Het
Cd4 C T 6: 124,870,244 probably null Het
Ceacam5 A T 7: 17,745,566 I203L probably benign Het
Ckap2 C A 8: 22,175,074 R458L probably damaging Het
Cldn10 T C 14: 118,861,859 probably null Het
Col27a1 C T 4: 63,318,283 R1377C unknown Het
Cry1 A T 10: 85,143,120 M514K probably benign Het
Crybg2 T G 4: 134,072,984 V176G probably damaging Het
Cyp2j5 C T 4: 96,659,612 G131D possibly damaging Het
Ddx46 A G 13: 55,669,722 Y720C probably damaging Het
Dock10 A T 1: 80,648,289 V44D probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam184a C T 10: 53,647,041 A956T probably damaging Het
Fbxw10 A T 11: 62,850,661 R202* probably null Het
Fnip1 A G 11: 54,502,388 E550G probably damaging Het
Gm37596 A T 3: 93,692,763 C100S probably benign Het
Gm8300 C T 12: 87,517,003 A36V probably damaging Het
Gpr149 A G 3: 62,530,711 L675P probably damaging Het
Hivep3 T C 4: 120,132,357 Y2002H probably benign Het
Hp A G 8: 109,575,555 Y254H probably damaging Het
Ighg1 G T 12: 113,330,337 T62N Het
Jcad A G 18: 4,672,700 E154G probably damaging Het
Kmt2a A G 9: 44,849,140 S471P probably damaging Het
Med13 A G 11: 86,278,526 V1968A probably damaging Het
Mknk2 T A 10: 80,675,867 Q3L probably benign Het
Nup98 G A 7: 102,194,822 T65I probably benign Het
Olfr1028 A G 2: 85,951,998 T312A probably benign Het
Olfr1499 A T 19: 13,815,236 M118K probably damaging Het
Olfr585 G A 7: 103,097,946 M68I probably damaging Het
Olfr763 T A 10: 129,012,065 M260K possibly damaging Het
Pcdhgb4 C T 18: 37,722,010 T486I probably benign Het
Perm1 T A 4: 156,218,534 F512I probably damaging Het
Pgap3 A T 11: 98,390,401 L262Q probably damaging Het
Pklr A C 3: 89,141,507 Y126S probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppm1k T C 6: 57,524,828 T117A probably benign Het
Prkd2 G A 7: 16,850,319 E366K probably benign Het
Psd C A 19: 46,324,730 C67F possibly damaging Het
Ptpa T A 2: 30,432,044 F100L probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rock1 T C 18: 10,112,357 E466G probably damaging Het
Sec16b A T 1: 157,554,757 M588L probably benign Het
Serpina1f T A 12: 103,693,690 H111L probably damaging Het
Shcbp1 A T 8: 4,748,812 L369Q possibly damaging Het
Spef2 A G 15: 9,601,085 M1697T unknown Het
St7 G A 6: 17,844,912 C133Y probably damaging Het
Tex19.1 T A 11: 121,147,160 W115R possibly damaging Het
Tfrc T A 16: 32,630,221 I726N probably benign Het
Trim43a C T 9: 88,582,185 P50S probably benign Het
Trpm4 A T 7: 45,308,681 V935E probably damaging Het
Ttc12 A T 9: 49,470,320 V117D possibly damaging Het
Ulbp1 T C 10: 7,457,053 T82A probably damaging Het
Usp13 C T 3: 32,876,940 H288Y probably damaging Het
Vmn2r82 A G 10: 79,396,245 K693E possibly damaging Het
Vmn2r90 A G 17: 17,712,304 T158A probably damaging Het
Vps8 A G 16: 21,477,872 K540R possibly damaging Het
Zfp709 G T 8: 71,890,089 C454F probably damaging Het
Other mutations in Sf3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sf3a1 APN 11 4171063 missense probably damaging 1.00
IGL02883:Sf3a1 APN 11 4179192 missense probably damaging 1.00
IGL03061:Sf3a1 APN 11 4175493 missense probably damaging 1.00
R1469:Sf3a1 UTSW 11 4175380 splice site probably benign
R1561:Sf3a1 UTSW 11 4179217 missense probably benign
R1905:Sf3a1 UTSW 11 4176678 missense probably benign 0.01
R1993:Sf3a1 UTSW 11 4179177 missense possibly damaging 0.51
R2264:Sf3a1 UTSW 11 4177443 missense probably benign 0.28
R3935:Sf3a1 UTSW 11 4180024 splice site probably null
R3936:Sf3a1 UTSW 11 4180024 splice site probably null
R4065:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4067:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4245:Sf3a1 UTSW 11 4167774 missense probably damaging 1.00
R5167:Sf3a1 UTSW 11 4177456 missense possibly damaging 0.71
R5434:Sf3a1 UTSW 11 4174041 missense probably damaging 1.00
R7471:Sf3a1 UTSW 11 4167724 missense possibly damaging 0.94
R7506:Sf3a1 UTSW 11 4177561 missense probably benign 0.02
R8039:Sf3a1 UTSW 11 4167787 missense probably damaging 1.00
R8074:Sf3a1 UTSW 11 4175435 nonsense probably null
R8299:Sf3a1 UTSW 11 4179420 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGAGTGGTCACAGAGGTTG -3'
(R):5'- CTAACCCACAAAGAGAGGCTGG -3'

Sequencing Primer
(F):5'- ACAGGGTTTCTCTGTGTAGCCC -3'
(R):5'- TGGACTGCAAACCTTCTGG -3'
Posted On2020-09-15