Incidental Mutation 'R7943:Appl1'
ID649183
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7943 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26945568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 377 (I377L)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably benign
Transcript: ENSMUST00000036570
AA Change: I377L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: I377L

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,686,222 T205I probably benign Het
Acsbg1 T C 9: 54,622,737 H225R probably damaging Het
Anks1 T A 17: 27,985,204 Y209N probably damaging Het
Arl9 A T 5: 77,010,548 D159V probably damaging Het
Arsa A C 15: 89,474,089 L339R probably damaging Het
C2 A G 17: 34,872,378 L380P probably damaging Het
Ccdc13 A G 9: 121,799,130 C97R unknown Het
Ccdc74a A G 16: 17,650,552 H346R probably benign Het
Ccnl1 T C 3: 65,956,905 I152V probably benign Het
Cd4 C T 6: 124,870,244 probably null Het
Ceacam5 A T 7: 17,745,566 I203L probably benign Het
Ckap2 C A 8: 22,175,074 R458L probably damaging Het
Cldn10 T C 14: 118,861,859 probably null Het
Col27a1 C T 4: 63,318,283 R1377C unknown Het
Cry1 A T 10: 85,143,120 M514K probably benign Het
Crybg2 T G 4: 134,072,984 V176G probably damaging Het
Cyp2j5 C T 4: 96,659,612 G131D possibly damaging Het
Ddx46 A G 13: 55,669,722 Y720C probably damaging Het
Dock10 A T 1: 80,648,289 V44D probably damaging Het
Enam A T 5: 88,488,551 probably null Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam184a C T 10: 53,647,041 A956T probably damaging Het
Fbxw10 A T 11: 62,850,661 R202* probably null Het
Fnip1 A G 11: 54,502,388 E550G probably damaging Het
Gm37596 A T 3: 93,692,763 C100S probably benign Het
Gm8300 C T 12: 87,517,003 A36V probably damaging Het
Gpr149 A G 3: 62,530,711 L675P probably damaging Het
Hivep3 T C 4: 120,132,357 Y2002H probably benign Het
Hp A G 8: 109,575,555 Y254H probably damaging Het
Ighg1 G T 12: 113,330,337 T62N Het
Jcad A G 18: 4,672,700 E154G probably damaging Het
Kmt2a A G 9: 44,849,140 S471P probably damaging Het
Med13 A G 11: 86,278,526 V1968A probably damaging Het
Mknk2 T A 10: 80,675,867 Q3L probably benign Het
Nup98 G A 7: 102,194,822 T65I probably benign Het
Olfr1028 A G 2: 85,951,998 T312A probably benign Het
Olfr1499 A T 19: 13,815,236 M118K probably damaging Het
Olfr585 G A 7: 103,097,946 M68I probably damaging Het
Olfr763 T A 10: 129,012,065 M260K possibly damaging Het
Pcdhgb4 C T 18: 37,722,010 T486I probably benign Het
Perm1 T A 4: 156,218,534 F512I probably damaging Het
Pgap3 A T 11: 98,390,401 L262Q probably damaging Het
Pklr A C 3: 89,141,507 Y126S probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppm1k T C 6: 57,524,828 T117A probably benign Het
Prkd2 G A 7: 16,850,319 E366K probably benign Het
Psd C A 19: 46,324,730 C67F possibly damaging Het
Ptpa T A 2: 30,432,044 F100L probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rock1 T C 18: 10,112,357 E466G probably damaging Het
Sec16b A T 1: 157,554,757 M588L probably benign Het
Serpina1f T A 12: 103,693,690 H111L probably damaging Het
Sf3a1 T C 11: 4,166,537 I76T possibly damaging Het
Shcbp1 A T 8: 4,748,812 L369Q possibly damaging Het
Spef2 A G 15: 9,601,085 M1697T unknown Het
St7 G A 6: 17,844,912 C133Y probably damaging Het
Tex19.1 T A 11: 121,147,160 W115R possibly damaging Het
Tfrc T A 16: 32,630,221 I726N probably benign Het
Thbs1 A G 2: 118,119,617 probably null Het
Trim43a C T 9: 88,582,185 P50S probably benign Het
Trpm4 A T 7: 45,308,681 V935E probably damaging Het
Ttc12 A T 9: 49,470,320 V117D possibly damaging Het
Ulbp1 T C 10: 7,457,053 T82A probably damaging Het
Usp13 C T 3: 32,876,940 H288Y probably damaging Het
Vmn2r82 A G 10: 79,396,245 K693E possibly damaging Het
Vmn2r90 A G 17: 17,712,304 T158A probably damaging Het
Vps8 A G 16: 21,477,872 K540R possibly damaging Het
Zfp143 T A 7: 110,072,474 probably null Het
Zfp709 G T 8: 71,890,089 C454F probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
R8379:Appl1 UTSW 14 26925415 critical splice donor site probably null
R8464:Appl1 UTSW 14 26953028 nonsense probably null
R8699:Appl1 UTSW 14 26940255 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTACACTGTAGCTACCCAAAC -3'
(R):5'- CATGCACACGTTTGTAGCGG -3'

Sequencing Primer
(F):5'- GTAGCTACCCAAACAGAATCATATGG -3'
(R):5'- ATTGGATCCACGGGTTCAC -3'
Posted On2020-09-15