Incidental Mutation 'R7944:Aig1'
ID 649235
Institutional Source Beutler Lab
Gene Symbol Aig1
Ensembl Gene ENSMUSG00000019806
Gene Name androgen-induced 1
Synonyms 1500031O19Rik, CGI-103
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7944 (G1)
Quality Score 209.009
Status Not validated
Chromosome 10
Chromosomal Location 13647054-13868980 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13868673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 29 (M29K)
Ref Sequence ENSEMBL: ENSMUSP00000019942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019942] [ENSMUST00000105534] [ENSMUST00000162610]
AlphaFold Q9D8B1
Predicted Effect probably damaging
Transcript: ENSMUST00000019942
AA Change: M29K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019942
Gene: ENSMUSG00000019806
AA Change: M29K

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.6e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105534
AA Change: M29K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101174
Gene: ENSMUSG00000019806
AA Change: M29K

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 178 3.4e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162610
AA Change: M29K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125366
Gene: ENSMUSG00000019806
AA Change: M29K

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.4e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Alms1 A T 6: 85,641,380 I2334F probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
Arap3 T C 18: 37,989,179 M619V probably benign Het
Asb13 T A 13: 3,649,413 F204L probably damaging Het
Btaf1 T C 19: 36,949,165 V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Ccna1 G T 3: 55,050,589 T165K possibly damaging Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Chil3 A C 3: 106,150,148 Y233* probably null Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Dlgap4 T A 2: 156,749,134 Y747N probably damaging Het
Dnah7b A G 1: 46,227,003 N2244S probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gale T C 4: 135,965,671 L75P probably damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hmx3 T G 7: 131,544,382 I273S probably damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Ifit1bl1 T A 19: 34,593,824 H411L probably benign Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mrto4 T C 4: 139,349,689 Y39C probably benign Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Mylk4 T C 13: 32,727,113 T221A probably benign Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Nup210 T G 6: 91,073,197 D430A probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Panx1 A G 9: 15,007,829 C245R probably damaging Het
Pcdha6 C A 18: 36,968,912 T386N possibly damaging Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Pkd2l2 T A 18: 34,427,428 Y363N possibly damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Rhbg A G 3: 88,247,700 L168P probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1a C A 13: 32,850,256 A51S probably benign Het
Serpinb6e T A 13: 33,832,605 T382S probably damaging Het
Sgip1 T G 4: 102,915,101 M229R probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Spsb1 T C 4: 149,906,446 I222V probably benign Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Trappc3 T C 4: 126,275,206 I163T probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Tuft1 G A 3: 94,632,602 P159S probably benign Het
Vmn2r108 T C 17: 20,471,628 H211R probably damaging Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zfp78 C T 7: 6,378,590 T213I possibly damaging Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Aig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Aig1 APN 10 13868674 missense probably damaging 0.99
IGL02715:Aig1 APN 10 13868616 critical splice donor site probably null
R0697:Aig1 UTSW 10 13829325 missense probably benign 0.01
R1699:Aig1 UTSW 10 13868622 missense possibly damaging 0.85
R1761:Aig1 UTSW 10 13690584 missense probably damaging 1.00
R3934:Aig1 UTSW 10 13801912 missense probably damaging 1.00
R4397:Aig1 UTSW 10 13652982 missense probably benign 0.00
R4736:Aig1 UTSW 10 13801930 missense probably damaging 0.97
R4767:Aig1 UTSW 10 13801858 missense probably damaging 1.00
R5081:Aig1 UTSW 10 13801900 missense probably benign 0.01
R5907:Aig1 UTSW 10 13801784 intron probably benign
R9105:Aig1 UTSW 10 13653595 missense probably benign 0.10
R9270:Aig1 UTSW 10 13653761 splice site probably null
R9381:Aig1 UTSW 10 13647673 missense probably benign 0.39
R9778:Aig1 UTSW 10 13653013 critical splice acceptor site probably null
X0018:Aig1 UTSW 10 13690524 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTTGGCTGTACTCCCATG -3'
(R):5'- GATGACGCCAGAGATGACAC -3'

Sequencing Primer
(F):5'- ATCCAGGCCTTCAGTGGAG -3'
(R):5'- CAGAGATGACACCAGGCCG -3'
Posted On 2020-09-15