Incidental Mutation 'R7944:Mtmr4'
ID649238
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87604428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 437 (V437A)
Ref Sequence ENSEMBL: ENSMUSP00000099468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628] [ENSMUST00000134216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092802
AA Change: V437A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: V437A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: V437A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: V437A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: V437A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: V437A

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134216
SMART Domains Protein: ENSMUSP00000119660
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 140 204 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Aig1 A T 10: 13,868,673 M29K probably damaging Het
Alms1 A T 6: 85,641,380 I2334F probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
Arap3 T C 18: 37,989,179 M619V probably benign Het
Asb13 T A 13: 3,649,413 F204L probably damaging Het
Btaf1 T C 19: 36,949,165 V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Ccna1 G T 3: 55,050,589 T165K possibly damaging Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Chil3 A C 3: 106,150,148 Y233* probably null Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Dlgap4 T A 2: 156,749,134 Y747N probably damaging Het
Dnah7b A G 1: 46,227,003 N2244S probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gale T C 4: 135,965,671 L75P probably damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hmx3 T G 7: 131,544,382 I273S probably damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Ifit1bl1 T A 19: 34,593,824 H411L probably benign Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mrto4 T C 4: 139,349,689 Y39C probably benign Het
Mylk4 T C 13: 32,727,113 T221A probably benign Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Nup210 T G 6: 91,073,197 D430A probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Panx1 A G 9: 15,007,829 C245R probably damaging Het
Pcdha6 C A 18: 36,968,912 T386N possibly damaging Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Pkd2l2 T A 18: 34,427,428 Y363N possibly damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Rhbg A G 3: 88,247,700 L168P probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1a C A 13: 32,850,256 A51S probably benign Het
Serpinb6e T A 13: 33,832,605 T382S probably damaging Het
Sgip1 T G 4: 102,915,101 M229R probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Spsb1 T C 4: 149,906,446 I222V probably benign Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Trappc3 T C 4: 126,275,206 I163T probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Tuft1 G A 3: 94,632,602 P159S probably benign Het
Vmn2r108 T C 17: 20,471,628 H211R probably damaging Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zfp78 C T 7: 6,378,590 T213I possibly damaging Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87611930 nonsense probably null
R8544:Mtmr4 UTSW 11 87611909 missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87604124 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AAGTGTCTAGGGAATGCTTCAG -3'
(R):5'- GCCTTCAGGACACGATTCTC -3'

Sequencing Primer
(F):5'- CTTCAGTAGAGGACACGGTGC -3'
(R):5'- GGCCTCAGGACTTACCAGAAATG -3'
Posted On2020-09-15