Incidental Mutation 'R7944:Wapl'
ID 649246
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 045990-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7944 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34399105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: I58T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: I58T

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: I58T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T A 8: 13,271,929 (GRCm39) R1610W probably damaging Het
Aig1 A T 10: 13,744,417 (GRCm39) M29K probably damaging Het
Alms1 A T 6: 85,618,362 (GRCm39) I2334F probably benign Het
Ano6 A G 15: 95,839,190 (GRCm39) Y423C probably damaging Het
Arap3 T C 18: 38,122,232 (GRCm39) M619V probably benign Het
Armh4 T A 14: 50,010,670 (GRCm39) T346S probably benign Het
Asb13 T A 13: 3,699,413 (GRCm39) F204L probably damaging Het
Btaf1 T C 19: 36,926,565 (GRCm39) V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 (GRCm39) T1661A probably benign Het
Ccna1 G T 3: 54,958,010 (GRCm39) T165K possibly damaging Het
Cdc42ep1 T A 15: 78,731,973 (GRCm39) S139R possibly damaging Het
Chil3 A C 3: 106,057,464 (GRCm39) Y233* probably null Het
Clec1a T C 6: 129,409,150 (GRCm39) S159G probably benign Het
Cltc A T 11: 86,627,967 (GRCm39) N60K probably benign Het
Dlgap4 T A 2: 156,591,054 (GRCm39) Y747N probably damaging Het
Dnah7b A G 1: 46,266,163 (GRCm39) N2244S probably benign Het
Ephb3 A G 16: 21,040,434 (GRCm39) T811A probably damaging Het
Fbxo21 T C 5: 118,146,212 (GRCm39) Y612H possibly damaging Het
Gale T C 4: 135,692,982 (GRCm39) L75P probably damaging Het
Golgb1 T C 16: 36,734,466 (GRCm39) S1279P probably benign Het
Hdgfl3 T C 7: 81,583,706 (GRCm39) Y22C possibly damaging Het
Hmx3 T G 7: 131,146,111 (GRCm39) I273S probably damaging Het
Hpse2 T C 19: 43,373,248 (GRCm39) N127S probably benign Het
Hsf2bp C T 17: 32,226,743 (GRCm39) R204H probably damaging Het
Ifit1bl1 T A 19: 34,571,224 (GRCm39) H411L probably benign Het
Krtap27-1 T C 16: 88,468,340 (GRCm39) N68S probably benign Het
Ltbp1 T G 17: 75,697,546 (GRCm39) *1713G probably null Het
Lypd6b A G 2: 49,833,612 (GRCm39) E84G probably damaging Het
Meiosin T A 7: 18,834,011 (GRCm39) K508N unknown Het
Mrgprx2 T C 7: 48,132,753 (GRCm39) T22A probably benign Het
Mrto4 T C 4: 139,077,000 (GRCm39) Y39C probably benign Het
Mtmr4 T C 11: 87,495,254 (GRCm39) V437A probably damaging Het
Mylk4 T C 13: 32,911,096 (GRCm39) T221A probably benign Het
Neb T C 2: 52,161,360 (GRCm39) D2144G probably damaging Het
Nup210 T G 6: 91,050,179 (GRCm39) D430A probably damaging Het
Obscn T A 11: 58,984,235 (GRCm39) E1740V probably damaging Het
Or8i2 A G 2: 86,852,657 (GRCm39) V77A probably benign Het
Panx1 A G 9: 14,919,125 (GRCm39) C245R probably damaging Het
Pcdha6 C A 18: 37,101,965 (GRCm39) T386N possibly damaging Het
Pcsk1 G A 13: 75,280,211 (GRCm39) A679T probably benign Het
Pdzph1 T C 17: 59,239,455 (GRCm39) T958A probably damaging Het
Pkd2l2 T A 18: 34,560,481 (GRCm39) Y363N possibly damaging Het
Plekha5 T A 6: 140,526,201 (GRCm39) H946Q possibly damaging Het
Rhbg A G 3: 88,155,007 (GRCm39) L168P probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rtn2 T A 7: 19,020,987 (GRCm39) S153R probably benign Het
Serpinb1a C A 13: 33,034,239 (GRCm39) A51S probably benign Het
Serpinb6e T A 13: 34,016,588 (GRCm39) T382S probably damaging Het
Sgip1 T G 4: 102,772,298 (GRCm39) M229R probably benign Het
Slc1a5 C A 7: 16,523,807 (GRCm39) R271S possibly damaging Het
Slc23a3 A G 1: 75,106,040 (GRCm39) probably null Het
Slc7a6 C T 8: 106,906,239 (GRCm39) P157L possibly damaging Het
Spsb1 T C 4: 149,990,903 (GRCm39) I222V probably benign Het
Syne2 A T 12: 75,951,079 (GRCm39) E410V probably damaging Het
Trappc3 T C 4: 126,168,999 (GRCm39) I163T probably damaging Het
Treh T C 9: 44,592,584 (GRCm39) V63A probably damaging Het
Ttc6 T G 12: 57,707,229 (GRCm39) L712R possibly damaging Het
Ttn G T 2: 76,715,309 (GRCm39) Q7928K unknown Het
Tuft1 G A 3: 94,539,909 (GRCm39) P159S probably benign Het
Vmn2r108 T C 17: 20,691,890 (GRCm39) H211R probably damaging Het
Zfp78 C T 7: 6,381,589 (GRCm39) T213I possibly damaging Het
Zmat4 T A 8: 24,238,436 (GRCm39) I6N possibly damaging Het
Zp3r G T 1: 130,524,560 (GRCm39) P226Q probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TTTCACAGGGAATATGAAACAGGTG -3'
(R):5'- CGGAAGCAAAACTGTCTTCACC -3'

Sequencing Primer
(F):5'- GGAATATGAAACAGGTGTCAAAATG -3'
(R):5'- CCACATGACTACATTTGCTATTAGC -3'
Posted On 2020-09-15