Incidental Mutation 'R7944:Ano6'
ID649250
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95941309 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 423 (Y423C)
Ref Sequence ENSEMBL: ENSMUSP00000071770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: Y423C

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227151
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: Y444C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Aig1 A T 10: 13,868,673 M29K probably damaging Het
Alms1 A T 6: 85,641,380 I2334F probably benign Het
Arap3 T C 18: 37,989,179 M619V probably benign Het
Asb13 T A 13: 3,649,413 F204L probably damaging Het
Btaf1 T C 19: 36,949,165 V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Ccna1 G T 3: 55,050,589 T165K possibly damaging Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Chil3 A C 3: 106,150,148 Y233* probably null Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Dlgap4 T A 2: 156,749,134 Y747N probably damaging Het
Dnah7b A G 1: 46,227,003 N2244S probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gale T C 4: 135,965,671 L75P probably damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hmx3 T G 7: 131,544,382 I273S probably damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Ifit1bl1 T A 19: 34,593,824 H411L probably benign Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mrto4 T C 4: 139,349,689 Y39C probably benign Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Mylk4 T C 13: 32,727,113 T221A probably benign Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Nup210 T G 6: 91,073,197 D430A probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Panx1 A G 9: 15,007,829 C245R probably damaging Het
Pcdha6 C A 18: 36,968,912 T386N possibly damaging Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Pkd2l2 T A 18: 34,427,428 Y363N possibly damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Rhbg A G 3: 88,247,700 L168P probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1a C A 13: 32,850,256 A51S probably benign Het
Serpinb6e T A 13: 33,832,605 T382S probably damaging Het
Sgip1 T G 4: 102,915,101 M229R probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Spsb1 T C 4: 149,906,446 I222V probably benign Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Trappc3 T C 4: 126,275,206 I163T probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Tuft1 G A 3: 94,632,602 P159S probably benign Het
Vmn2r108 T C 17: 20,471,628 H211R probably damaging Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zfp78 C T 7: 6,378,590 T213I possibly damaging Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
R8903:Ano6 UTSW 15 95927582 missense probably benign 0.05
R8923:Ano6 UTSW 15 95913547 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAGTGGTAATTCCCAGC -3'
(R):5'- GATCACATTGTGAACCACTGCAG -3'

Sequencing Primer
(F):5'- AATTCCCAGCATGGAGTCTG -3'
(R):5'- ACCTTGCTGAGAACCTGTAGG -3'
Posted On2020-09-15