Incidental Mutation 'R7944:Pdzph1'
ID 649256
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 045990-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7944 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59239455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 958 (T958A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably damaging
Transcript: ENSMUST00000025064
AA Change: T958A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: T958A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T A 8: 13,271,929 (GRCm39) R1610W probably damaging Het
Aig1 A T 10: 13,744,417 (GRCm39) M29K probably damaging Het
Alms1 A T 6: 85,618,362 (GRCm39) I2334F probably benign Het
Ano6 A G 15: 95,839,190 (GRCm39) Y423C probably damaging Het
Arap3 T C 18: 38,122,232 (GRCm39) M619V probably benign Het
Armh4 T A 14: 50,010,670 (GRCm39) T346S probably benign Het
Asb13 T A 13: 3,699,413 (GRCm39) F204L probably damaging Het
Btaf1 T C 19: 36,926,565 (GRCm39) V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 (GRCm39) T1661A probably benign Het
Ccna1 G T 3: 54,958,010 (GRCm39) T165K possibly damaging Het
Cdc42ep1 T A 15: 78,731,973 (GRCm39) S139R possibly damaging Het
Chil3 A C 3: 106,057,464 (GRCm39) Y233* probably null Het
Clec1a T C 6: 129,409,150 (GRCm39) S159G probably benign Het
Cltc A T 11: 86,627,967 (GRCm39) N60K probably benign Het
Dlgap4 T A 2: 156,591,054 (GRCm39) Y747N probably damaging Het
Dnah7b A G 1: 46,266,163 (GRCm39) N2244S probably benign Het
Ephb3 A G 16: 21,040,434 (GRCm39) T811A probably damaging Het
Fbxo21 T C 5: 118,146,212 (GRCm39) Y612H possibly damaging Het
Gale T C 4: 135,692,982 (GRCm39) L75P probably damaging Het
Golgb1 T C 16: 36,734,466 (GRCm39) S1279P probably benign Het
Hdgfl3 T C 7: 81,583,706 (GRCm39) Y22C possibly damaging Het
Hmx3 T G 7: 131,146,111 (GRCm39) I273S probably damaging Het
Hpse2 T C 19: 43,373,248 (GRCm39) N127S probably benign Het
Hsf2bp C T 17: 32,226,743 (GRCm39) R204H probably damaging Het
Ifit1bl1 T A 19: 34,571,224 (GRCm39) H411L probably benign Het
Krtap27-1 T C 16: 88,468,340 (GRCm39) N68S probably benign Het
Ltbp1 T G 17: 75,697,546 (GRCm39) *1713G probably null Het
Lypd6b A G 2: 49,833,612 (GRCm39) E84G probably damaging Het
Meiosin T A 7: 18,834,011 (GRCm39) K508N unknown Het
Mrgprx2 T C 7: 48,132,753 (GRCm39) T22A probably benign Het
Mrto4 T C 4: 139,077,000 (GRCm39) Y39C probably benign Het
Mtmr4 T C 11: 87,495,254 (GRCm39) V437A probably damaging Het
Mylk4 T C 13: 32,911,096 (GRCm39) T221A probably benign Het
Neb T C 2: 52,161,360 (GRCm39) D2144G probably damaging Het
Nup210 T G 6: 91,050,179 (GRCm39) D430A probably damaging Het
Obscn T A 11: 58,984,235 (GRCm39) E1740V probably damaging Het
Or8i2 A G 2: 86,852,657 (GRCm39) V77A probably benign Het
Panx1 A G 9: 14,919,125 (GRCm39) C245R probably damaging Het
Pcdha6 C A 18: 37,101,965 (GRCm39) T386N possibly damaging Het
Pcsk1 G A 13: 75,280,211 (GRCm39) A679T probably benign Het
Pkd2l2 T A 18: 34,560,481 (GRCm39) Y363N possibly damaging Het
Plekha5 T A 6: 140,526,201 (GRCm39) H946Q possibly damaging Het
Rhbg A G 3: 88,155,007 (GRCm39) L168P probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rtn2 T A 7: 19,020,987 (GRCm39) S153R probably benign Het
Serpinb1a C A 13: 33,034,239 (GRCm39) A51S probably benign Het
Serpinb6e T A 13: 34,016,588 (GRCm39) T382S probably damaging Het
Sgip1 T G 4: 102,772,298 (GRCm39) M229R probably benign Het
Slc1a5 C A 7: 16,523,807 (GRCm39) R271S possibly damaging Het
Slc23a3 A G 1: 75,106,040 (GRCm39) probably null Het
Slc7a6 C T 8: 106,906,239 (GRCm39) P157L possibly damaging Het
Spsb1 T C 4: 149,990,903 (GRCm39) I222V probably benign Het
Syne2 A T 12: 75,951,079 (GRCm39) E410V probably damaging Het
Trappc3 T C 4: 126,168,999 (GRCm39) I163T probably damaging Het
Treh T C 9: 44,592,584 (GRCm39) V63A probably damaging Het
Ttc6 T G 12: 57,707,229 (GRCm39) L712R possibly damaging Het
Ttn G T 2: 76,715,309 (GRCm39) Q7928K unknown Het
Tuft1 G A 3: 94,539,909 (GRCm39) P159S probably benign Het
Vmn2r108 T C 17: 20,691,890 (GRCm39) H211R probably damaging Het
Wapl T C 14: 34,399,105 (GRCm39) I58T probably benign Het
Zfp78 C T 7: 6,381,589 (GRCm39) T213I possibly damaging Het
Zmat4 T A 8: 24,238,436 (GRCm39) I6N possibly damaging Het
Zp3r G T 1: 130,524,560 (GRCm39) P226Q probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAGGATACAATGTCCTGTTG -3'
(R):5'- GTCTAACTTGGAAGGAAAGGCTC -3'

Sequencing Primer
(F):5'- CAATGTCCTGTTGATAAAGGCATCCC -3'
(R):5'- GGCTCTATAGAAAAAGTCTCTCTCTC -3'
Posted On 2020-09-15