Incidental Mutation 'R7944:Ifit1bl1'
ID649261
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7944 (G1)
Quality Score163.009
Status Not validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34593824 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 411 (H411L)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect probably benign
Transcript: ENSMUST00000112467
AA Change: H411L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: H411L

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168254
AA Change: H411L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: H411L

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Aig1 A T 10: 13,868,673 M29K probably damaging Het
Alms1 A T 6: 85,641,380 I2334F probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
Arap3 T C 18: 37,989,179 M619V probably benign Het
Asb13 T A 13: 3,649,413 F204L probably damaging Het
Btaf1 T C 19: 36,949,165 V79A probably benign Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Ccna1 G T 3: 55,050,589 T165K possibly damaging Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Chil3 A C 3: 106,150,148 Y233* probably null Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Dlgap4 T A 2: 156,749,134 Y747N probably damaging Het
Dnah7b A G 1: 46,227,003 N2244S probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gale T C 4: 135,965,671 L75P probably damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hmx3 T G 7: 131,544,382 I273S probably damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hsf2bp C T 17: 32,007,769 R204H probably damaging Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mrto4 T C 4: 139,349,689 Y39C probably benign Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Mylk4 T C 13: 32,727,113 T221A probably benign Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Nup210 T G 6: 91,073,197 D430A probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Panx1 A G 9: 15,007,829 C245R probably damaging Het
Pcdha6 C A 18: 36,968,912 T386N possibly damaging Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Pkd2l2 T A 18: 34,427,428 Y363N possibly damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Rhbg A G 3: 88,247,700 L168P probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1a C A 13: 32,850,256 A51S probably benign Het
Serpinb6e T A 13: 33,832,605 T382S probably damaging Het
Sgip1 T G 4: 102,915,101 M229R probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Spsb1 T C 4: 149,906,446 I222V probably benign Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Trappc3 T C 4: 126,275,206 I163T probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Tuft1 G A 3: 94,632,602 P159S probably benign Het
Vmn2r108 T C 17: 20,471,628 H211R probably damaging Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zfp78 C T 7: 6,378,590 T213I possibly damaging Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R8251:Ifit1bl1 UTSW 19 34594832 missense possibly damaging 0.85
R8427:Ifit1bl1 UTSW 19 34599266 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTCAAAACTCAGGGTTCACTG -3'
(R):5'- GGCATATGTTACTCTGGCTGAAATG -3'

Sequencing Primer
(F):5'- AAACTCAGGGTTCACTGCTCCTG -3'
(R):5'- CTCTGGCTGAAATGTACATTGAG -3'
Posted On2020-09-15