Incidental Mutation 'R7945:Ppat'
ID649279
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Namephosphoribosyl pyrophosphate amidotransferase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7945 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76913249-76951578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76915391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 458 (V458L)
Ref Sequence ENSEMBL: ENSMUSP00000120632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
Predicted Effect probably benign
Transcript: ENSMUST00000140076
AA Change: V458L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246
AA Change: V458L

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
4932438A13Rik G A 3: 36,965,893 V2093I probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Afg3l1 C A 8: 123,489,922 A300E probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
BC005561 G T 5: 104,518,547 V312F possibly damaging Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Cep57 A G 9: 13,818,931 Y104H probably damaging Het
Chrna4 T C 2: 181,028,661 D434G probably benign Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Cpq T A 15: 33,594,236 D464E probably benign Het
Ctcfl A C 2: 173,118,658 V44G probably benign Het
Dcstamp T A 15: 39,760,401 *471R probably null Het
Disp2 G A 2: 118,792,789 R1334H probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fam208b A T 13: 3,576,085 S1288R probably benign Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Gm8005 T A 14: 42,438,373 D102V Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Lipo3 T C 19: 33,556,431 M334V probably benign Het
Lrrc34 A G 3: 30,642,737 probably null Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mitd1 T C 1: 37,885,265 Y68C probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Olfr1344 A G 7: 6,440,355 T152A probably benign Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdap1 G A 5: 145,131,439 A138V probably damaging Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Rock1 A G 18: 10,116,831 L435P probably damaging Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1c A T 13: 32,886,209 H123Q probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Trim50 T A 5: 135,353,302 W3R probably benign Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Ugt3a1 T C 15: 9,284,175 probably null Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zgrf1 A G 3: 127,562,760 E545G probably benign Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 76915232 missense probably damaging 1.00
IGL02679:Ppat APN 5 76919469 missense probably benign 0.10
R0836:Ppat UTSW 5 76922501 missense probably benign 0.09
R2327:Ppat UTSW 5 76922467 missense possibly damaging 0.94
R2850:Ppat UTSW 5 76919375 missense probably benign
R3434:Ppat UTSW 5 76918065 missense probably damaging 0.99
R4301:Ppat UTSW 5 76928501 intron probably benign
R4422:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4423:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4424:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4839:Ppat UTSW 5 76950964 nonsense probably null
R4872:Ppat UTSW 5 76926793 missense probably damaging 0.99
R5007:Ppat UTSW 5 76928678 intron probably benign
R5010:Ppat UTSW 5 76928678 intron probably benign
R5325:Ppat UTSW 5 76928422 intron probably benign
R5982:Ppat UTSW 5 76915265 missense probably benign
R6209:Ppat UTSW 5 76918146 missense probably benign 0.00
R6225:Ppat UTSW 5 76922355 missense probably damaging 0.99
R6287:Ppat UTSW 5 76918214 nonsense probably null
R7367:Ppat UTSW 5 76919864 nonsense probably null
R7426:Ppat UTSW 5 76915979 missense probably damaging 0.99
R8047:Ppat UTSW 5 76925710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCAGCTCCACAGGGTAC -3'
(R):5'- AGAGGATCTATCACATGCATTCC -3'

Sequencing Primer
(F):5'- TACTGCCCAGTGAGGCAAG -3'
(R):5'- TGGCTTGAACTTAGCACCG -3'
Posted On2020-09-15