Incidental Mutation 'R7945:Ppat'
ID 649279
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Name phosphoribosyl pyrophosphate amidotransferase
Synonyms 5730454C12Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7945 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 77061096-77099425 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 77063238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 458 (V458L)
Ref Sequence ENSEMBL: ENSMUSP00000120632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
AlphaFold Q8CIH9
Predicted Effect probably benign
Transcript: ENSMUST00000140076
AA Change: V458L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246
AA Change: V458L

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T A 8: 13,271,929 (GRCm39) R1610W probably damaging Het
Afg3l1 C A 8: 124,216,661 (GRCm39) A300E probably benign Het
Ano6 A G 15: 95,839,190 (GRCm39) Y423C probably damaging Het
Armh4 T A 14: 50,010,670 (GRCm39) T346S probably benign Het
Bltp1 G A 3: 37,020,042 (GRCm39) V2093I probably benign Het
Casp8ap2 A G 4: 32,645,909 (GRCm39) T1661A probably benign Het
Cdc42ep1 T A 15: 78,731,973 (GRCm39) S139R possibly damaging Het
Cep57 A G 9: 13,730,227 (GRCm39) Y104H probably damaging Het
Chrna4 T C 2: 180,670,454 (GRCm39) D434G probably benign Het
Clec1a T C 6: 129,409,150 (GRCm39) S159G probably benign Het
Cltc A T 11: 86,627,967 (GRCm39) N60K probably benign Het
Cpq T A 15: 33,594,382 (GRCm39) D464E probably benign Het
Ctcfl A C 2: 172,960,451 (GRCm39) V44G probably benign Het
Dcstamp T A 15: 39,623,797 (GRCm39) *471R probably null Het
Disp2 G A 2: 118,623,270 (GRCm39) R1334H probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,326,227 (GRCm39) probably benign Het
Ephb3 A G 16: 21,040,434 (GRCm39) T811A probably damaging Het
Fbxo21 T C 5: 118,146,212 (GRCm39) Y612H possibly damaging Het
Gm8005 T A 14: 42,260,330 (GRCm39) D102V Het
Golgb1 T C 16: 36,734,466 (GRCm39) S1279P probably benign Het
Hdgfl3 T C 7: 81,583,706 (GRCm39) Y22C possibly damaging Het
Hpse2 T C 19: 43,373,248 (GRCm39) N127S probably benign Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Krtap27-1 T C 16: 88,468,340 (GRCm39) N68S probably benign Het
Lipo3 T C 19: 33,533,831 (GRCm39) M334V probably benign Het
Lrrc34 A G 3: 30,696,886 (GRCm39) probably null Het
Ltbp1 T G 17: 75,697,546 (GRCm39) *1713G probably null Het
Lypd6b A G 2: 49,833,612 (GRCm39) E84G probably damaging Het
Meiosin T A 7: 18,834,011 (GRCm39) K508N unknown Het
Mitd1 T C 1: 37,924,346 (GRCm39) Y68C probably damaging Het
Mrgprx2 T C 7: 48,132,753 (GRCm39) T22A probably benign Het
Mroh4 C T 15: 74,496,554 (GRCm39) E278K probably damaging Het
Mtmr4 T C 11: 87,495,254 (GRCm39) V437A probably damaging Het
Neb T C 2: 52,161,360 (GRCm39) D2144G probably damaging Het
Obscn T A 11: 58,984,235 (GRCm39) E1740V probably damaging Het
Or2bd2 A G 7: 6,443,354 (GRCm39) T152A probably benign Het
Or8i2 A G 2: 86,852,657 (GRCm39) V77A probably benign Het
Pcsk1 G A 13: 75,280,211 (GRCm39) A679T probably benign Het
Pdap1 G A 5: 145,068,249 (GRCm39) A138V probably damaging Het
Pdzph1 T C 17: 59,239,455 (GRCm39) T958A probably damaging Het
Plekha5 T A 6: 140,526,201 (GRCm39) H946Q possibly damaging Het
Rock1 A G 18: 10,116,831 (GRCm39) L435P probably damaging Het
Rtn2 T A 7: 19,020,987 (GRCm39) S153R probably benign Het
Serpinb1c A T 13: 33,070,192 (GRCm39) H123Q probably benign Het
Slc1a5 C A 7: 16,523,807 (GRCm39) R271S possibly damaging Het
Slc23a3 A G 1: 75,106,040 (GRCm39) probably null Het
Slc7a6 C T 8: 106,906,239 (GRCm39) P157L possibly damaging Het
Syne2 A T 12: 75,951,079 (GRCm39) E410V probably damaging Het
Tasor2 A T 13: 3,626,085 (GRCm39) S1288R probably benign Het
Thoc2l G T 5: 104,666,413 (GRCm39) V312F possibly damaging Het
Treh T C 9: 44,592,584 (GRCm39) V63A probably damaging Het
Trim50 T A 5: 135,382,156 (GRCm39) W3R probably benign Het
Ttc6 T G 12: 57,707,229 (GRCm39) L712R possibly damaging Het
Ttn G T 2: 76,715,309 (GRCm39) Q7928K unknown Het
Ugt3a1 T C 15: 9,284,261 (GRCm39) probably null Het
Wapl T C 14: 34,399,105 (GRCm39) I58T probably benign Het
Zgrf1 A G 3: 127,356,409 (GRCm39) E545G probably benign Het
Zmat4 T A 8: 24,238,436 (GRCm39) I6N possibly damaging Het
Zp3r G T 1: 130,524,560 (GRCm39) P226Q probably damaging Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 77,063,079 (GRCm39) missense probably damaging 1.00
IGL02679:Ppat APN 5 77,067,316 (GRCm39) missense probably benign 0.10
R0836:Ppat UTSW 5 77,070,348 (GRCm39) missense probably benign 0.09
R2327:Ppat UTSW 5 77,070,314 (GRCm39) missense possibly damaging 0.94
R2850:Ppat UTSW 5 77,067,222 (GRCm39) missense probably benign
R3434:Ppat UTSW 5 77,065,912 (GRCm39) missense probably damaging 0.99
R4301:Ppat UTSW 5 77,076,348 (GRCm39) intron probably benign
R4422:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4423:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4424:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4839:Ppat UTSW 5 77,098,811 (GRCm39) nonsense probably null
R4872:Ppat UTSW 5 77,074,640 (GRCm39) missense probably damaging 0.99
R5007:Ppat UTSW 5 77,076,525 (GRCm39) intron probably benign
R5010:Ppat UTSW 5 77,076,525 (GRCm39) intron probably benign
R5325:Ppat UTSW 5 77,076,269 (GRCm39) intron probably benign
R5982:Ppat UTSW 5 77,063,112 (GRCm39) missense probably benign
R6209:Ppat UTSW 5 77,065,993 (GRCm39) missense probably benign 0.00
R6225:Ppat UTSW 5 77,070,202 (GRCm39) missense probably damaging 0.99
R6287:Ppat UTSW 5 77,066,061 (GRCm39) nonsense probably null
R7367:Ppat UTSW 5 77,067,711 (GRCm39) nonsense probably null
R7426:Ppat UTSW 5 77,063,826 (GRCm39) missense probably damaging 0.99
R8047:Ppat UTSW 5 77,073,557 (GRCm39) missense probably damaging 1.00
R9343:Ppat UTSW 5 77,063,884 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ATTCCAGCTCCACAGGGTAC -3'
(R):5'- AGAGGATCTATCACATGCATTCC -3'

Sequencing Primer
(F):5'- TACTGCCCAGTGAGGCAAG -3'
(R):5'- TGGCTTGAACTTAGCACCG -3'
Posted On 2020-09-15