Incidental Mutation 'R7945:Wapl'
ID649307
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7945 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34677148 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: I58T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: I58T

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: I58T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
4932438A13Rik G A 3: 36,965,893 V2093I probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Afg3l1 C A 8: 123,489,922 A300E probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
BC005561 G T 5: 104,518,547 V312F possibly damaging Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Cdc42ep1 T A 15: 78,847,773 S139R possibly damaging Het
Cep57 A G 9: 13,818,931 Y104H probably damaging Het
Chrna4 T C 2: 181,028,661 D434G probably benign Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Cpq T A 15: 33,594,236 D464E probably benign Het
Ctcfl A C 2: 173,118,658 V44G probably benign Het
Dcstamp T A 15: 39,760,401 *471R probably null Het
Disp2 G A 2: 118,792,789 R1334H probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fam208b A T 13: 3,576,085 S1288R probably benign Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Gm8005 T A 14: 42,438,373 D102V Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Lipo3 T C 19: 33,556,431 M334V probably benign Het
Lrrc34 A G 3: 30,642,737 probably null Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mitd1 T C 1: 37,885,265 Y68C probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Olfr1344 A G 7: 6,440,355 T152A probably benign Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdap1 G A 5: 145,131,439 A138V probably damaging Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Ppat C A 5: 76,915,391 V458L probably benign Het
Rock1 A G 18: 10,116,831 L435P probably damaging Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1c A T 13: 32,886,209 H123Q probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Trim50 T A 5: 135,353,302 W3R probably benign Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Ugt3a1 T C 15: 9,284,175 probably null Het
Zgrf1 A G 3: 127,562,760 E545G probably benign Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTTCACAGGGAATATGAAACAGGTG -3'
(R):5'- GGAAGCAAAACTGTCTTCACC -3'

Sequencing Primer
(F):5'- GGAATATGAAACAGGTGTCAAAATG -3'
(R):5'- CCACATGACTACATTTGCTATTAGC -3'
Posted On2020-09-15