Incidental Mutation 'R7946:Caprin1'
ID649331
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R7946 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103772748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 490 (V490E)
Ref Sequence ENSEMBL: ENSMUSP00000028607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect probably damaging
Transcript: ENSMUST00000028607
AA Change: V490E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: V490E

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111147
AA Change: V490E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: V490E

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143188
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184
AA Change: V11E

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik G T 2: 118,759,665 P233T probably benign Het
Abca16 A G 7: 120,527,175 T1186A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Afap1 G A 5: 35,984,052 probably null Het
Afap1 A G 5: 35,935,651 N33S probably benign Het
Ampd3 A G 7: 110,777,940 D46G probably damaging Het
Anks4b A G 7: 120,182,484 K246R probably benign Het
Aqp9 C T 9: 71,123,008 V192M probably damaging Het
Aspscr1 T G 11: 120,708,617 S132A Het
Atp2b4 C A 1: 133,730,582 R530L probably damaging Het
Bahcc1 T C 11: 120,272,499 V541A probably benign Het
Ccdc7a T A 8: 128,917,146 K734M probably damaging Het
Cdc16 A G 8: 13,762,882 K138R probably benign Het
Cela2a A G 4: 141,822,306 S53P possibly damaging Het
Clca3a2 A G 3: 144,807,314 probably null Het
Cntrob T C 11: 69,315,221 E373G possibly damaging Het
Csmd2 T C 4: 128,520,265 Y2633H Het
Ctbp1 A T 5: 33,250,344 M296K probably benign Het
Dido1 G T 2: 180,661,708 Q1468K possibly damaging Het
Dnah7b T C 1: 46,233,579 F2289S probably damaging Het
Fam212b T A 3: 105,716,445 L45H probably damaging Het
Fndc7 T A 3: 108,872,136 D364V possibly damaging Het
Ggt7 G T 2: 155,505,972 H180Q probably damaging Het
Gm14399 A T 2: 175,131,480 C161S probably damaging Het
Gm17324 T C 9: 78,448,512 T62A unknown Het
Gpr107 A G 2: 31,188,704 I384V probably damaging Het
Igsf10 C A 3: 59,319,704 V2183L possibly damaging Het
Il23r T A 6: 67,434,664 H363L possibly damaging Het
Iqsec1 A T 6: 90,690,270 I291N probably damaging Het
Kcnc3 A T 7: 44,596,145 T620S probably benign Het
Kif2b T C 11: 91,575,745 N571D probably benign Het
Klrb1c T A 6: 128,789,109 probably benign Het
Mgst2 A G 3: 51,677,570 N55S probably damaging Het
Neb T C 2: 52,212,734 D4509G probably damaging Het
Obox1 G T 7: 15,555,531 V82F probably benign Het
Olfr1301 A T 2: 111,754,818 M190L probably benign Het
Olfr483 A G 7: 108,103,846 D179G probably benign Het
Olfr868 T C 9: 20,101,484 S242P probably damaging Het
Palm2 A T 4: 57,710,045 N330I probably damaging Het
Phf21a A T 2: 92,359,167 E590D probably damaging Het
Rai14 T C 15: 10,574,201 probably null Het
Rfx7 T C 9: 72,616,814 Y429H probably damaging Het
Spata31d1d G T 13: 59,730,792 A77E probably benign Het
Stra8 A G 6: 34,930,881 probably null Het
Syne1 A G 10: 5,250,919 S3550P possibly damaging Het
Tars2 A T 3: 95,750,381 H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 E22G probably benign Het
Tor1a A G 2: 30,963,692 probably null Het
Trim43b A G 9: 89,091,485 I65T probably damaging Het
Ubr3 T C 2: 69,951,395 M640T possibly damaging Het
Vegfa A T 17: 46,025,451 Y248N probably damaging Het
Vmn1r172 T G 7: 23,659,432 probably null Het
Vmn1r29 G T 6: 58,307,849 V185F probably benign Het
Wdfy4 T C 14: 33,070,748 K2114E Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 splice site probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R2945:Caprin1 UTSW 2 103772809 missense probably benign 0.04
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6108:Caprin1 UTSW 2 103776017 missense possibly damaging 0.93
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7624:Caprin1 UTSW 2 103772677 missense possibly damaging 0.81
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8324:Caprin1 UTSW 2 103783181 nonsense probably null
R8547:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8549:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8782:Caprin1 UTSW 2 103772788 missense probably benign 0.06
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCTAACCTTTGGAGTAAAGC -3'
(R):5'- CAAGCATCAGTTGGCATGG -3'

Sequencing Primer
(F):5'- AGGCTCAAATATACTACTAAAAAGCC -3'
(R):5'- AGTTGGCATGGTACTTTATAAATGTG -3'
Posted On2020-09-15