Incidental Mutation 'R0018:Dspp'
ID64934
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0018 (G1)
Quality Score173
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104178230 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 820 (S820C)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: S820C
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: S820C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
R7585:Dspp UTSW 5 104175525 missense possibly damaging 0.90
R7662:Dspp UTSW 5 104177870 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCAGTAGTAGTGACAGCAGTGAC -3'
(R):5'- GGTTCCACACAGTCTGCACATCTC -3'

Sequencing Primer
(F):5'- acagtagtgacagtagtgacag -3'
(R):5'- tcactgtcactgtcactgtc -3'
Posted On2013-08-06