Incidental Mutation 'R7946:Aqp9'
ID649363
Institutional Source Beutler Lab
Gene Symbol Aqp9
Ensembl Gene ENSMUSG00000032204
Gene Nameaquaporin 9
Synonyms1700020I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7946 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71110659-71168682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71123008 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 192 (V192M)
Ref Sequence ENSEMBL: ENSMUSP00000050127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060917] [ENSMUST00000074465] [ENSMUST00000113570] [ENSMUST00000144618]
Predicted Effect probably damaging
Transcript: ENSMUST00000060917
AA Change: V192M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050127
Gene: ENSMUSG00000032204
AA Change: V192M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:MIP 58 288 1.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074465
AA Change: V166M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074063
Gene: ENSMUSG00000032204
AA Change: V166M

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113570
AA Change: V166M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204
AA Change: V166M

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144618
SMART Domains Protein: ENSMUSP00000116785
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 164 9.4e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the aquaglyceroporin subfamily of aquaporins. This protein transports water, glycerol, urea, purines and pyrimidines and plays a role in glycerol metabolism and osteoclast differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele have increased glycerol and triglyceride levels, increased resistance to glycerol-induced lysis, decreased glycerol permeability, and decreased susceptibility to the early stages of parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik G T 2: 118,759,665 P233T probably benign Het
Abca16 A G 7: 120,527,175 T1186A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Afap1 A G 5: 35,935,651 N33S probably benign Het
Afap1 G A 5: 35,984,052 probably null Het
Ampd3 A G 7: 110,777,940 D46G probably damaging Het
Anks4b A G 7: 120,182,484 K246R probably benign Het
Aspscr1 T G 11: 120,708,617 S132A Het
Atp2b4 C A 1: 133,730,582 R530L probably damaging Het
Bahcc1 T C 11: 120,272,499 V541A probably benign Het
Caprin1 A T 2: 103,772,748 V490E probably damaging Het
Ccdc7a T A 8: 128,917,146 K734M probably damaging Het
Cdc16 A G 8: 13,762,882 K138R probably benign Het
Cela2a A G 4: 141,822,306 S53P possibly damaging Het
Clca3a2 A G 3: 144,807,314 probably null Het
Cntrob T C 11: 69,315,221 E373G possibly damaging Het
Csmd2 T C 4: 128,520,265 Y2633H Het
Ctbp1 A T 5: 33,250,344 M296K probably benign Het
Dido1 G T 2: 180,661,708 Q1468K possibly damaging Het
Dnah7b T C 1: 46,233,579 F2289S probably damaging Het
Fam212b T A 3: 105,716,445 L45H probably damaging Het
Fndc7 T A 3: 108,872,136 D364V possibly damaging Het
Ggt7 G T 2: 155,505,972 H180Q probably damaging Het
Gm14399 A T 2: 175,131,480 C161S probably damaging Het
Gm17324 T C 9: 78,448,512 T62A unknown Het
Gpr107 A G 2: 31,188,704 I384V probably damaging Het
Igsf10 C A 3: 59,319,704 V2183L possibly damaging Het
Il23r T A 6: 67,434,664 H363L possibly damaging Het
Iqsec1 A T 6: 90,690,270 I291N probably damaging Het
Kcnc3 A T 7: 44,596,145 T620S probably benign Het
Kif2b T C 11: 91,575,745 N571D probably benign Het
Klrb1c T A 6: 128,789,109 probably benign Het
Mgst2 A G 3: 51,677,570 N55S probably damaging Het
Neb T C 2: 52,212,734 D4509G probably damaging Het
Obox1 G T 7: 15,555,531 V82F probably benign Het
Olfr1301 A T 2: 111,754,818 M190L probably benign Het
Olfr483 A G 7: 108,103,846 D179G probably benign Het
Olfr868 T C 9: 20,101,484 S242P probably damaging Het
Palm2 A T 4: 57,710,045 N330I probably damaging Het
Phf21a A T 2: 92,359,167 E590D probably damaging Het
Rai14 T C 15: 10,574,201 probably null Het
Rfx7 T C 9: 72,616,814 Y429H probably damaging Het
Spata31d1d G T 13: 59,730,792 A77E probably benign Het
Stra8 A G 6: 34,930,881 probably null Het
Syne1 A G 10: 5,250,919 S3550P possibly damaging Het
Tars2 A T 3: 95,750,381 H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 E22G probably benign Het
Tor1a A G 2: 30,963,692 probably null Het
Trim43b A G 9: 89,091,485 I65T probably damaging Het
Ubr3 T C 2: 69,951,395 M640T possibly damaging Het
Vegfa A T 17: 46,025,451 Y248N probably damaging Het
Vmn1r172 T G 7: 23,659,432 probably null Het
Vmn1r29 G T 6: 58,307,849 V185F probably benign Het
Wdfy4 T C 14: 33,070,748 K2114E Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Aqp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Aqp9 APN 9 71132731 missense probably damaging 1.00
IGL01012:Aqp9 APN 9 71130549 splice site probably benign
IGL01667:Aqp9 APN 9 71138213 missense probably benign 0.13
IGL02225:Aqp9 APN 9 71130547 splice site probably benign
IGL02389:Aqp9 APN 9 71122906 missense possibly damaging 0.80
IGL02551:Aqp9 APN 9 71132640 missense probably damaging 0.98
IGL02904:Aqp9 APN 9 71138148 missense probably damaging 0.98
R0411:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R0751:Aqp9 UTSW 9 71138205 missense probably damaging 1.00
R1656:Aqp9 UTSW 9 71138103 missense probably benign 0.01
R1731:Aqp9 UTSW 9 71122968 missense possibly damaging 0.91
R1733:Aqp9 UTSW 9 71112342 missense possibly damaging 0.67
R1865:Aqp9 UTSW 9 71112376 missense probably benign 0.29
R4058:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R4756:Aqp9 UTSW 9 71163049 missense probably damaging 1.00
R4771:Aqp9 UTSW 9 71122870 missense probably damaging 1.00
R4904:Aqp9 UTSW 9 71162403 intron probably benign
R5334:Aqp9 UTSW 9 71123010 critical splice acceptor site probably null
R5511:Aqp9 UTSW 9 71163093 utr 5 prime probably benign
R5771:Aqp9 UTSW 9 71122864 missense probably damaging 1.00
R6329:Aqp9 UTSW 9 71132684 nonsense probably null
R6831:Aqp9 UTSW 9 71162420 intron probably benign
R6838:Aqp9 UTSW 9 71112216 missense probably benign 0.41
R7337:Aqp9 UTSW 9 71162482 missense probably benign 0.23
R7466:Aqp9 UTSW 9 71163261 splice site probably null
R8316:Aqp9 UTSW 9 71138213 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTACGTGAAGACCTCAAATCCC -3'
(R):5'- ACGATCCTGTCAGTGTCTGC -3'

Sequencing Primer
(F):5'- TCCCCATCCTGCCAGAG -3'
(R):5'- GAACTCACTTTGTAGACCAGGCTG -3'
Posted On2020-09-15