Incidental Mutation 'R7946:Cntrob'
ID 649368
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 045991-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R7946 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69206047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 373 (E373G)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: E373G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: E373G

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,126,398 (GRCm39) T1186A probably benign Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Afap1 A G 5: 36,092,995 (GRCm39) N33S probably benign Het
Afap1 G A 5: 36,141,396 (GRCm39) probably null Het
Ampd3 A G 7: 110,377,147 (GRCm39) D46G probably damaging Het
Anks4b A G 7: 119,781,707 (GRCm39) K246R probably benign Het
Aqp9 C T 9: 71,030,290 (GRCm39) V192M probably damaging Het
Aspscr1 T G 11: 120,599,443 (GRCm39) S132A Het
Atp2b4 C A 1: 133,658,320 (GRCm39) R530L probably damaging Het
Bahcc1 T C 11: 120,163,325 (GRCm39) V541A probably benign Het
Caprin1 A T 2: 103,603,093 (GRCm39) V490E probably damaging Het
Ccdc7a T A 8: 129,643,627 (GRCm39) K734M probably damaging Het
Ccdc9b G T 2: 118,590,146 (GRCm39) P233T probably benign Het
Cdc16 A G 8: 13,812,882 (GRCm39) K138R probably benign Het
Cela2a A G 4: 141,549,617 (GRCm39) S53P possibly damaging Het
Clca3a2 A G 3: 144,513,075 (GRCm39) probably null Het
Csmd2 T C 4: 128,414,058 (GRCm39) Y2633H Het
Ctbp1 A T 5: 33,407,688 (GRCm39) M296K probably benign Het
Dido1 G T 2: 180,303,501 (GRCm39) Q1468K possibly damaging Het
Dnah7b T C 1: 46,272,739 (GRCm39) F2289S probably damaging Het
Fndc7 T A 3: 108,779,452 (GRCm39) D364V possibly damaging Het
Ggt7 G T 2: 155,347,892 (GRCm39) H180Q probably damaging Het
Gm14399 A T 2: 174,973,273 (GRCm39) C161S probably damaging Het
Gm17324 T C 9: 78,355,794 (GRCm39) T62A unknown Het
Gpr107 A G 2: 31,078,716 (GRCm39) I384V probably damaging Het
Igsf10 C A 3: 59,227,125 (GRCm39) V2183L possibly damaging Het
Il23r T A 6: 67,411,648 (GRCm39) H363L possibly damaging Het
Inka2 T A 3: 105,623,761 (GRCm39) L45H probably damaging Het
Iqsec1 A T 6: 90,667,252 (GRCm39) I291N probably damaging Het
Kcnc3 A T 7: 44,245,569 (GRCm39) T620S probably benign Het
Kif2b T C 11: 91,466,571 (GRCm39) N571D probably benign Het
Klrb1c T A 6: 128,766,072 (GRCm39) probably benign Het
Mgst2 A G 3: 51,584,991 (GRCm39) N55S probably damaging Het
Neb T C 2: 52,102,746 (GRCm39) D4509G probably damaging Het
Obox1 G T 7: 15,289,456 (GRCm39) V82F probably benign Het
Or4k51 A T 2: 111,585,163 (GRCm39) M190L probably benign Het
Or5p59 A G 7: 107,703,053 (GRCm39) D179G probably benign Het
Or7e174 T C 9: 20,012,780 (GRCm39) S242P probably damaging Het
Pakap A T 4: 57,710,045 (GRCm39) N330I probably damaging Het
Phf21a A T 2: 92,189,512 (GRCm39) E590D probably damaging Het
Rai14 T C 15: 10,574,287 (GRCm39) probably null Het
Rfx7 T C 9: 72,524,096 (GRCm39) Y429H probably damaging Het
Spata31d1d G T 13: 59,878,606 (GRCm39) A77E probably benign Het
Stra8 A G 6: 34,907,816 (GRCm39) probably null Het
Syne1 A G 10: 5,200,919 (GRCm39) S3550P possibly damaging Het
Tars2 A T 3: 95,657,693 (GRCm39) H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 (GRCm39) E22G probably benign Het
Tor1a A G 2: 30,853,704 (GRCm39) probably null Het
Trim43b A G 9: 88,973,538 (GRCm39) I65T probably damaging Het
Ubr3 T C 2: 69,781,739 (GRCm39) M640T possibly damaging Het
Vegfa A T 17: 46,336,377 (GRCm39) Y248N probably damaging Het
Vmn1r172 T G 7: 23,358,857 (GRCm39) probably null Het
Vmn1r29 G T 6: 58,284,834 (GRCm39) V185F probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wdfy4 T C 14: 32,792,705 (GRCm39) K2114E Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCTTCACACTGGTCCTCAAC -3'
(R):5'- CCTGGGGCTTTAGGAAGAAG -3'

Sequencing Primer
(F):5'- CAACCTTGCCTTCCATGTATAAC -3'
(R):5'- AAGCCCTGACTCTGAGGTTG -3'
Posted On 2020-09-15