Incidental Mutation 'R7946:Kif2b'
ID 649369
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock # R7946 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 91575315-91577558 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91575745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 571 (N571D)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect probably benign
Transcript: ENSMUST00000061019
AA Change: N571D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: N571D

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Meta Mutation Damage Score 0.1825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik G T 2: 118,759,665 P233T probably benign Het
Abca16 A G 7: 120,527,175 T1186A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Afap1 A G 5: 35,935,651 N33S probably benign Het
Afap1 G A 5: 35,984,052 probably null Het
Ampd3 A G 7: 110,777,940 D46G probably damaging Het
Anks4b A G 7: 120,182,484 K246R probably benign Het
Aqp9 C T 9: 71,123,008 V192M probably damaging Het
Aspscr1 T G 11: 120,708,617 S132A Het
Atp2b4 C A 1: 133,730,582 R530L probably damaging Het
Bahcc1 T C 11: 120,272,499 V541A probably benign Het
Caprin1 A T 2: 103,772,748 V490E probably damaging Het
Ccdc7a T A 8: 128,917,146 K734M probably damaging Het
Cdc16 A G 8: 13,762,882 K138R probably benign Het
Cela2a A G 4: 141,822,306 S53P possibly damaging Het
Clca3a2 A G 3: 144,807,314 probably null Het
Cntrob T C 11: 69,315,221 E373G possibly damaging Het
Csmd2 T C 4: 128,520,265 Y2633H Het
Ctbp1 A T 5: 33,250,344 M296K probably benign Het
Dido1 G T 2: 180,661,708 Q1468K possibly damaging Het
Dnah7b T C 1: 46,233,579 F2289S probably damaging Het
Fam212b T A 3: 105,716,445 L45H probably damaging Het
Fndc7 T A 3: 108,872,136 D364V possibly damaging Het
Ggt7 G T 2: 155,505,972 H180Q probably damaging Het
Gm14399 A T 2: 175,131,480 C161S probably damaging Het
Gm17324 T C 9: 78,448,512 T62A unknown Het
Gpr107 A G 2: 31,188,704 I384V probably damaging Het
Igsf10 C A 3: 59,319,704 V2183L possibly damaging Het
Il23r T A 6: 67,434,664 H363L possibly damaging Het
Iqsec1 A T 6: 90,690,270 I291N probably damaging Het
Kcnc3 A T 7: 44,596,145 T620S probably benign Het
Klrb1c T A 6: 128,789,109 probably benign Het
Mgst2 A G 3: 51,677,570 N55S probably damaging Het
Neb T C 2: 52,212,734 D4509G probably damaging Het
Obox1 G T 7: 15,555,531 V82F probably benign Het
Olfr1301 A T 2: 111,754,818 M190L probably benign Het
Olfr483 A G 7: 108,103,846 D179G probably benign Het
Olfr868 T C 9: 20,101,484 S242P probably damaging Het
Palm2 A T 4: 57,710,045 N330I probably damaging Het
Phf21a A T 2: 92,359,167 E590D probably damaging Het
Rai14 T C 15: 10,574,201 probably null Het
Rfx7 T C 9: 72,616,814 Y429H probably damaging Het
Spata31d1d G T 13: 59,730,792 A77E probably benign Het
Stra8 A G 6: 34,930,881 probably null Het
Syne1 A G 10: 5,250,919 S3550P possibly damaging Het
Tars2 A T 3: 95,750,381 H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 E22G probably benign Het
Tor1a A G 2: 30,963,692 probably null Het
Trim43b A G 9: 89,091,485 I65T probably damaging Het
Ubr3 T C 2: 69,951,395 M640T possibly damaging Het
Vegfa A T 17: 46,025,451 Y248N probably damaging Het
Vmn1r172 T G 7: 23,659,432 probably null Het
Vmn1r29 G T 6: 58,307,849 V185F probably benign Het
Wdfy4 T C 14: 33,070,748 K2114E Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8969:Kif2b UTSW 11 91577193 missense probably benign 0.00
R9002:Kif2b UTSW 11 91576227 missense probably benign 0.30
R9028:Kif2b UTSW 11 91577185 missense probably benign
R9039:Kif2b UTSW 11 91576305 missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91575828 missense probably damaging 1.00
R9114:Kif2b UTSW 11 91575712 missense possibly damaging 0.77
R9279:Kif2b UTSW 11 91577149 missense probably benign 0.01
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCACATCACCGTTGACTC -3'
(R):5'- CAAACTCACGCAGGTGCTAC -3'

Sequencing Primer
(F):5'- ACATCACCGTTGACTCCCTCAG -3'
(R):5'- GGATTCCTTCATAGGGCAGAACTC -3'
Posted On 2020-09-15