Incidental Mutation 'R7946:Kif2b'
ID649369
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Namekinesin family member 2B
Synonyms1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R7946 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location91575315-91577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91575745 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 571 (N571D)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
Predicted Effect probably benign
Transcript: ENSMUST00000061019
AA Change: N571D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: N571D

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Meta Mutation Damage Score 0.1825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik G T 2: 118,759,665 P233T probably benign Het
Abca16 A G 7: 120,527,175 T1186A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Afap1 A G 5: 35,935,651 N33S probably benign Het
Afap1 G A 5: 35,984,052 probably null Het
Ampd3 A G 7: 110,777,940 D46G probably damaging Het
Anks4b A G 7: 120,182,484 K246R probably benign Het
Aqp9 C T 9: 71,123,008 V192M probably damaging Het
Aspscr1 T G 11: 120,708,617 S132A Het
Atp2b4 C A 1: 133,730,582 R530L probably damaging Het
Bahcc1 T C 11: 120,272,499 V541A probably benign Het
Caprin1 A T 2: 103,772,748 V490E probably damaging Het
Ccdc7a T A 8: 128,917,146 K734M probably damaging Het
Cdc16 A G 8: 13,762,882 K138R probably benign Het
Cela2a A G 4: 141,822,306 S53P possibly damaging Het
Clca3a2 A G 3: 144,807,314 probably null Het
Cntrob T C 11: 69,315,221 E373G possibly damaging Het
Csmd2 T C 4: 128,520,265 Y2633H Het
Ctbp1 A T 5: 33,250,344 M296K probably benign Het
Dido1 G T 2: 180,661,708 Q1468K possibly damaging Het
Dnah7b T C 1: 46,233,579 F2289S probably damaging Het
Fam212b T A 3: 105,716,445 L45H probably damaging Het
Fndc7 T A 3: 108,872,136 D364V possibly damaging Het
Ggt7 G T 2: 155,505,972 H180Q probably damaging Het
Gm14399 A T 2: 175,131,480 C161S probably damaging Het
Gm17324 T C 9: 78,448,512 T62A unknown Het
Gpr107 A G 2: 31,188,704 I384V probably damaging Het
Igsf10 C A 3: 59,319,704 V2183L possibly damaging Het
Il23r T A 6: 67,434,664 H363L possibly damaging Het
Iqsec1 A T 6: 90,690,270 I291N probably damaging Het
Kcnc3 A T 7: 44,596,145 T620S probably benign Het
Klrb1c T A 6: 128,789,109 probably benign Het
Mgst2 A G 3: 51,677,570 N55S probably damaging Het
Neb T C 2: 52,212,734 D4509G probably damaging Het
Obox1 G T 7: 15,555,531 V82F probably benign Het
Olfr1301 A T 2: 111,754,818 M190L probably benign Het
Olfr483 A G 7: 108,103,846 D179G probably benign Het
Olfr868 T C 9: 20,101,484 S242P probably damaging Het
Palm2 A T 4: 57,710,045 N330I probably damaging Het
Phf21a A T 2: 92,359,167 E590D probably damaging Het
Rai14 T C 15: 10,574,201 probably null Het
Rfx7 T C 9: 72,616,814 Y429H probably damaging Het
Spata31d1d G T 13: 59,730,792 A77E probably benign Het
Stra8 A G 6: 34,930,881 probably null Het
Syne1 A G 10: 5,250,919 S3550P possibly damaging Het
Tars2 A T 3: 95,750,381 H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 E22G probably benign Het
Tor1a A G 2: 30,963,692 probably null Het
Trim43b A G 9: 89,091,485 I65T probably damaging Het
Ubr3 T C 2: 69,951,395 M640T possibly damaging Het
Vegfa A T 17: 46,025,451 Y248N probably damaging Het
Vmn1r172 T G 7: 23,659,432 probably null Het
Vmn1r29 G T 6: 58,307,849 V185F probably benign Het
Wdfy4 T C 14: 33,070,748 K2114E Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCACATCACCGTTGACTC -3'
(R):5'- CAAACTCACGCAGGTGCTAC -3'

Sequencing Primer
(F):5'- ACATCACCGTTGACTCCCTCAG -3'
(R):5'- GGATTCCTTCATAGGGCAGAACTC -3'
Posted On2020-09-15