Incidental Mutation 'R7946:Spata31d1d'
ID649372
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7946 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59730792 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 77 (A77E)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect probably benign
Transcript: ENSMUST00000052978
AA Change: A77E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: A77E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik G T 2: 118,759,665 P233T probably benign Het
Abca16 A G 7: 120,527,175 T1186A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Afap1 A G 5: 35,935,651 N33S probably benign Het
Afap1 G A 5: 35,984,052 probably null Het
Ampd3 A G 7: 110,777,940 D46G probably damaging Het
Anks4b A G 7: 120,182,484 K246R probably benign Het
Aqp9 C T 9: 71,123,008 V192M probably damaging Het
Aspscr1 T G 11: 120,708,617 S132A Het
Atp2b4 C A 1: 133,730,582 R530L probably damaging Het
Bahcc1 T C 11: 120,272,499 V541A probably benign Het
Caprin1 A T 2: 103,772,748 V490E probably damaging Het
Ccdc7a T A 8: 128,917,146 K734M probably damaging Het
Cdc16 A G 8: 13,762,882 K138R probably benign Het
Cela2a A G 4: 141,822,306 S53P possibly damaging Het
Clca3a2 A G 3: 144,807,314 probably null Het
Cntrob T C 11: 69,315,221 E373G possibly damaging Het
Csmd2 T C 4: 128,520,265 Y2633H Het
Ctbp1 A T 5: 33,250,344 M296K probably benign Het
Dido1 G T 2: 180,661,708 Q1468K possibly damaging Het
Dnah7b T C 1: 46,233,579 F2289S probably damaging Het
Fam212b T A 3: 105,716,445 L45H probably damaging Het
Fndc7 T A 3: 108,872,136 D364V possibly damaging Het
Ggt7 G T 2: 155,505,972 H180Q probably damaging Het
Gm14399 A T 2: 175,131,480 C161S probably damaging Het
Gm17324 T C 9: 78,448,512 T62A unknown Het
Gpr107 A G 2: 31,188,704 I384V probably damaging Het
Igsf10 C A 3: 59,319,704 V2183L possibly damaging Het
Il23r T A 6: 67,434,664 H363L possibly damaging Het
Iqsec1 A T 6: 90,690,270 I291N probably damaging Het
Kcnc3 A T 7: 44,596,145 T620S probably benign Het
Kif2b T C 11: 91,575,745 N571D probably benign Het
Klrb1c T A 6: 128,789,109 probably benign Het
Mgst2 A G 3: 51,677,570 N55S probably damaging Het
Neb T C 2: 52,212,734 D4509G probably damaging Het
Obox1 G T 7: 15,555,531 V82F probably benign Het
Olfr1301 A T 2: 111,754,818 M190L probably benign Het
Olfr483 A G 7: 108,103,846 D179G probably benign Het
Olfr868 T C 9: 20,101,484 S242P probably damaging Het
Palm2 A T 4: 57,710,045 N330I probably damaging Het
Phf21a A T 2: 92,359,167 E590D probably damaging Het
Rai14 T C 15: 10,574,201 probably null Het
Rfx7 T C 9: 72,616,814 Y429H probably damaging Het
Stra8 A G 6: 34,930,881 probably null Het
Syne1 A G 10: 5,250,919 S3550P possibly damaging Het
Tars2 A T 3: 95,750,381 H249Q probably damaging Het
Tomm5 T C 4: 45,107,969 E22G probably benign Het
Tor1a A G 2: 30,963,692 probably null Het
Trim43b A G 9: 89,091,485 I65T probably damaging Het
Ubr3 T C 2: 69,951,395 M640T possibly damaging Het
Vegfa A T 17: 46,025,451 Y248N probably damaging Het
Vmn1r172 T G 7: 23,659,432 probably null Het
Vmn1r29 G T 6: 58,307,849 V185F probably benign Het
Wdfy4 T C 14: 33,070,748 K2114E Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
R8206:Spata31d1d UTSW 13 59731530 missense probably benign 0.03
R8912:Spata31d1d UTSW 13 59727322 missense possibly damaging 0.53
Z1176:Spata31d1d UTSW 13 59726167 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGGTATCATTGCTTCCTGCC -3'
(R):5'- CCAGCCTGAAACTTGCAGATG -3'

Sequencing Primer
(F):5'- CTTCCTGCCTGTGGTGAGC -3'
(R):5'- GCCTGAAACTTGCAGATGAAAATC -3'
Posted On2020-09-15